\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005711741:

Variant ID: vg1005711741 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5711741
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCCGCGGAGGGGAGGCGGAGAAGGATCACGGCGAGGAGGCGGTCGTCGAGCTCCGCCGTGGCGTCCATGGCGGGAGGCGACCGCGCTTTCCTCTTCCC[G/A]
TTCCCGGCCATTTTCTACTCAAACGCAATGCGCGGTTGGGTTTTGGGATTTGGGATTTGGGAAGATGGCGATGGTTTCGGGCGGCGAGATGGGAGGGAGA

Reverse complement sequence

TCTCCCTCCCATCTCGCCGCCCGAAACCATCGCCATCTTCCCAAATCCCAAATCCCAAAACCCAACCGCGCATTGCGTTTGAGTAGAAAATGGCCGGGAA[C/T]
GGGAAGAGGAAAGCGCGGTCGCCTCCCGCCATGGACGCCACGGCGGAGCTCGACGACCGCCTCCTCGCCGTGATCCTTCTCCGCCTCCCCTCCGCGGCCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.00% 15.70% 0.21% 0.00% NA
All Indica  2759 80.40% 19.40% 0.22% 0.00% NA
All Japonica  1512 86.40% 13.30% 0.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 77.20% 22.40% 0.43% 0.00% NA
Indica III  913 69.70% 30.20% 0.11% 0.00% NA
Indica Intermediate  786 81.00% 18.60% 0.38% 0.00% NA
Temperate Japonica  767 94.80% 5.10% 0.13% 0.00% NA
Tropical Japonica  504 82.30% 17.30% 0.40% 0.00% NA
Japonica Intermediate  241 68.50% 31.10% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005711741 G -> A LOC_Os10g10390.1 upstream_gene_variant ; 31.0bp to feature; MODIFIER silent_mutation Average:64.399; most accessible tissue: Zhenshan97 young leaf, score: 88.878 N N N N
vg1005711741 G -> A LOC_Os10g10380.1 downstream_gene_variant ; 1782.0bp to feature; MODIFIER silent_mutation Average:64.399; most accessible tissue: Zhenshan97 young leaf, score: 88.878 N N N N
vg1005711741 G -> A LOC_Os10g10400.1 downstream_gene_variant ; 2591.0bp to feature; MODIFIER silent_mutation Average:64.399; most accessible tissue: Zhenshan97 young leaf, score: 88.878 N N N N
vg1005711741 G -> A LOC_Os10g10390-LOC_Os10g10400 intergenic_region ; MODIFIER silent_mutation Average:64.399; most accessible tissue: Zhenshan97 young leaf, score: 88.878 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005711741 NA 3.78E-10 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 2.52E-06 1.91E-10 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 5.84E-06 3.52E-09 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 7.40E-06 8.91E-10 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 3.95E-06 NA mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 4.20E-10 1.03E-20 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 NA 7.33E-08 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 NA 6.12E-07 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 NA 1.12E-09 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 NA 2.29E-14 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 NA 4.82E-09 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 4.43E-06 3.19E-09 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 1.62E-06 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 2.03E-08 1.09E-21 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 NA 9.87E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 NA 6.42E-14 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 NA 1.99E-08 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 NA 2.84E-07 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 9.91E-06 1.41E-13 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 NA 3.56E-10 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 NA 1.18E-06 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 NA 1.78E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 NA 5.80E-10 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 NA 3.08E-11 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 NA 1.21E-08 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 6.04E-06 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 1.40E-08 1.54E-19 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 NA 2.18E-08 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 8.92E-06 3.25E-11 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 NA 4.01E-09 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 NA 7.28E-10 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 1.31E-08 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 8.71E-07 9.29E-09 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 4.39E-07 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 1.89E-08 1.48E-21 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 1.93E-06 2.95E-19 mr1794_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 NA 1.34E-11 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005711741 NA 1.05E-06 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251