\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005691507:

Variant ID: vg1005691507 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5691507
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGTGAGCGATGCGGTCACCGGAGATGAGCACAACCGCTGGGGCACCACGCTTTCTCGATCGGAGGCCAGCACGATGGAGGAGGTTGCGGGAGAGACGC[T/C]
GTCACACGCTGTTGATCCGGTTCCTTGCTACTAGATCAGGATGCAGTCCCATTTTTTTCGTAATCTGCATGTAATCCTAGGGTTGGAGGAAAGGCACTGT

Reverse complement sequence

ACAGTGCCTTTCCTCCAACCCTAGGATTACATGCAGATTACGAAAAAAATGGGACTGCATCCTGATCTAGTAGCAAGGAACCGGATCAACAGCGTGTGAC[A/G]
GCGTCTCTCCCGCAACCTCCTCCATCGTGCTGGCCTCCGATCGAGAAAGCGTGGTGCCCCAGCGGTTGTGCTCATCTCCGGTGACCGCATCGCTCACTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 43.70% 0.13% 0.28% NA
All Indica  2759 76.70% 22.80% 0.11% 0.36% NA
All Japonica  1512 9.20% 90.70% 0.00% 0.13% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.20% 1.70% 0.17% 0.00% NA
Indica II  465 75.10% 24.10% 0.00% 0.86% NA
Indica III  913 62.90% 36.60% 0.11% 0.44% NA
Indica Intermediate  786 77.50% 22.10% 0.13% 0.25% NA
Temperate Japonica  767 13.70% 86.30% 0.00% 0.00% NA
Tropical Japonica  504 2.80% 97.20% 0.00% 0.00% NA
Japonica Intermediate  241 8.30% 90.90% 0.00% 0.83% NA
VI/Aromatic  96 72.90% 26.00% 1.04% 0.00% NA
Intermediate  90 51.10% 45.60% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005691507 T -> C LOC_Os10g10350.1 downstream_gene_variant ; 2241.0bp to feature; MODIFIER silent_mutation Average:66.415; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg1005691507 T -> C LOC_Os10g10360.1 downstream_gene_variant ; 1938.0bp to feature; MODIFIER silent_mutation Average:66.415; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg1005691507 T -> C LOC_Os10g10360.4 downstream_gene_variant ; 1938.0bp to feature; MODIFIER silent_mutation Average:66.415; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg1005691507 T -> C LOC_Os10g10360.3 downstream_gene_variant ; 1938.0bp to feature; MODIFIER silent_mutation Average:66.415; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg1005691507 T -> C LOC_Os10g10360.2 downstream_gene_variant ; 2838.0bp to feature; MODIFIER silent_mutation Average:66.415; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg1005691507 T -> C LOC_Os10g10350-LOC_Os10g10360 intergenic_region ; MODIFIER silent_mutation Average:66.415; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg1005691507 T -> DEL N N silent_mutation Average:66.415; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005691507 NA 2.12E-11 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 2.39E-06 4.18E-10 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 1.31E-06 2.11E-09 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 1.63E-06 4.63E-10 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 4.29E-24 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 7.27E-10 1.10E-20 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 3.18E-07 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 1.45E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 1.22E-10 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 1.34E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 5.86E-09 NA mr1210 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 1.18E-07 5.69E-11 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 3.66E-14 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 1.91E-06 1.16E-09 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 5.54E-07 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 1.87E-09 NA mr1305 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 5.37E-08 2.49E-11 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 2.17E-37 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 8.08E-09 1.03E-21 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 5.56E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 4.21E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 6.95E-08 1.95E-12 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 4.17E-08 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 1.30E-06 1.25E-09 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 3.62E-06 3.62E-06 mr1649 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 5.42E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 1.11E-09 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 6.58E-06 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 4.31E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 7.29E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 8.54E-06 1.21E-10 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 4.49E-06 2.68E-11 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 7.68E-09 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 6.17E-23 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 4.69E-08 1.06E-19 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 1.13E-08 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 2.63E-06 1.94E-12 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 1.08E-10 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 4.19E-06 9.21E-12 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 1.05E-06 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 1.74E-07 2.38E-09 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 4.04E-08 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 3.27E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 3.27E-34 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 3.88E-08 1.51E-20 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 4.82E-08 1.19E-12 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 7.00E-12 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 2.47E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005691507 NA 8.69E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251