\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005689748:

Variant ID: vg1005689748 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5689748
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCGATGTTTAATACTTCCTGATAAAAAAAACATTATTTATTATTTGTAGTTTAGGTTCCTTGTGGTAGAACTAACCTACCCTGGTTCAAGTCTAGACA[C/T]
GCCTACTCGCATTTATGGTTAATTATTCTTTCAGTGGTAGGCGATGTAGCCGTCGGTAGCGAGGCGTCCATATTGGTGACTTCGTCAATCTCAAGGTATG

Reverse complement sequence

CATACCTTGAGATTGACGAAGTCACCAATATGGACGCCTCGCTACCGACGGCTACATCGCCTACCACTGAAAGAATAATTAACCATAAATGCGAGTAGGC[G/A]
TGTCTAGACTTGAACCAGGGTAGGTTAGTTCTACCACAAGGAACCTAAACTACAAATAATAAATAATGTTTTTTTTATCAGGAAGTATTAAACATCGGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.90% 15.90% 0.23% 0.00% NA
All Indica  2759 80.20% 19.40% 0.33% 0.00% NA
All Japonica  1512 86.20% 13.70% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 77.00% 22.20% 0.86% 0.00% NA
Indica III  913 69.20% 30.40% 0.33% 0.00% NA
Indica Intermediate  786 80.90% 18.80% 0.25% 0.00% NA
Temperate Japonica  767 94.90% 5.10% 0.00% 0.00% NA
Tropical Japonica  504 82.10% 17.90% 0.00% 0.00% NA
Japonica Intermediate  241 67.20% 32.40% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005689748 C -> T LOC_Os10g10350.1 downstream_gene_variant ; 482.0bp to feature; MODIFIER silent_mutation Average:54.114; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N
vg1005689748 C -> T LOC_Os10g10360.1 downstream_gene_variant ; 3697.0bp to feature; MODIFIER silent_mutation Average:54.114; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N
vg1005689748 C -> T LOC_Os10g10360.4 downstream_gene_variant ; 3697.0bp to feature; MODIFIER silent_mutation Average:54.114; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N
vg1005689748 C -> T LOC_Os10g10360.3 downstream_gene_variant ; 3697.0bp to feature; MODIFIER silent_mutation Average:54.114; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N
vg1005689748 C -> T LOC_Os10g10360.2 downstream_gene_variant ; 4597.0bp to feature; MODIFIER silent_mutation Average:54.114; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N
vg1005689748 C -> T LOC_Os10g10350-LOC_Os10g10360 intergenic_region ; MODIFIER silent_mutation Average:54.114; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005689748 NA 3.29E-09 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748 NA 2.75E-07 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748 NA 7.39E-09 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748 NA 2.30E-12 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748 NA 2.03E-08 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748 5.56E-06 1.30E-07 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748 4.91E-07 1.92E-10 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748 NA 1.04E-11 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748 NA 7.84E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748 9.81E-06 NA mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748 3.64E-06 NA mr1913 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748 4.78E-06 2.34E-08 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748 NA 6.03E-07 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748 NA 1.58E-07 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748 NA 1.45E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748 NA 2.43E-12 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748 NA 6.86E-09 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748 NA 1.44E-08 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748 9.50E-07 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748 6.64E-06 6.53E-08 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748 NA 2.58E-12 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251