Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005689748:

Variant ID: vg1005689748 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5689748
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

ATCCGATGTTTAATACTTCCTGATAAAAAAAACATTATTTATTATTTGTAGTTTAGGTTCCTTGTGGTAGAACTAACCTACCCTGGTTCAAGTCTAGACA[C/T]
GCCTACTCGCATTTATGGTTAATTATTCTTTCAGTGGTAGGCGATGTAGCCGTCGGTAGCGAGGCGTCCATATTGGTGACTTCGTCAATCTCAAGGTATG

Reverse complement sequence

CATACCTTGAGATTGACGAAGTCACCAATATGGACGCCTCGCTACCGACGGCTACATCGCCTACCACTGAAAGAATAATTAACCATAAATGCGAGTAGGC[G/A]
TGTCTAGACTTGAACCAGGGTAGGTTAGTTCTACCACAAGGAACCTAAACTACAAATAATAAATAATGTTTTTTTTATCAGGAAGTATTAAACATCGGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.90%	15.90%	0.23%	0.00%	NA
All Indica	2759	80.20%	19.40%	0.33%	0.00%	NA
All Japonica	1512	86.20%	13.70%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.80%	1.20%	0.00%	0.00%	NA
Indica II	465	77.00%	22.20%	0.86%	0.00%	NA
Indica III	913	69.20%	30.40%	0.33%	0.00%	NA
Indica Intermediate	786	80.90%	18.80%	0.25%	0.00%	NA
Temperate Japonica	767	94.90%	5.10%	0.00%	0.00%	NA
Tropical Japonica	504	82.10%	17.90%	0.00%	0.00%	NA
Japonica Intermediate	241	67.20%	32.40%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	8.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005689748	C -> T	LOC_Os10g10350.1	downstream_gene_variant ; 482.0bp to feature; MODIFIER	silent_mutation	Average:54.114; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N
vg1005689748	C -> T	LOC_Os10g10360.1	downstream_gene_variant ; 3697.0bp to feature; MODIFIER	silent_mutation	Average:54.114; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N
vg1005689748	C -> T	LOC_Os10g10360.4	downstream_gene_variant ; 3697.0bp to feature; MODIFIER	silent_mutation	Average:54.114; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N
vg1005689748	C -> T	LOC_Os10g10360.3	downstream_gene_variant ; 3697.0bp to feature; MODIFIER	silent_mutation	Average:54.114; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N
vg1005689748	C -> T	LOC_Os10g10360.2	downstream_gene_variant ; 4597.0bp to feature; MODIFIER	silent_mutation	Average:54.114; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N
vg1005689748	C -> T	LOC_Os10g10350-LOC_Os10g10360	intergenic_region ; MODIFIER	silent_mutation	Average:54.114; most accessible tissue: Zhenshan97 young leaf, score: 73.923	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005689748	NA	3.29E-09	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748	NA	2.75E-07	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748	NA	7.39E-09	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748	NA	2.30E-12	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748	NA	2.03E-08	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748	5.56E-06	1.30E-07	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748	4.91E-07	1.92E-10	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748	NA	1.04E-11	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748	NA	7.84E-06	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748	9.81E-06	NA	mr1913	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748	3.64E-06	NA	mr1913	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748	4.78E-06	2.34E-08	mr1917	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748	NA	6.03E-07	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748	NA	1.58E-07	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748	NA	1.45E-06	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748	NA	2.43E-12	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748	NA	6.86E-09	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748	NA	1.44E-08	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748	9.50E-07	NA	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748	6.64E-06	6.53E-08	mr1258_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689748	NA	2.58E-12	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251