Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005689732:

Variant ID: vg1005689732 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5689732
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.73, G: 0.26, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

ACGGTTAAAAATGTGAATCCGATGTTTAATACTTCCTGATAAAAAAAACATTATTTATTATTTGTAGTTTAGGTTCCTTGTGGTAGAACTAACCTACCCT[G/A]
GTTCAAGTCTAGACACGCCTACTCGCATTTATGGTTAATTATTCTTTCAGTGGTAGGCGATGTAGCCGTCGGTAGCGAGGCGTCCATATTGGTGACTTCG

Reverse complement sequence

CGAAGTCACCAATATGGACGCCTCGCTACCGACGGCTACATCGCCTACCACTGAAAGAATAATTAACCATAAATGCGAGTAGGCGTGTCTAGACTTGAAC[C/T]
AGGGTAGGTTAGTTCTACCACAAGGAACCTAAACTACAAATAATAAATAATGTTTTTTTTATCAGGAAGTATTAAACATCGGATTCACATTTTTAACCGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.80%	45.80%	0.36%	0.00%	NA
All Indica	2759	76.20%	23.40%	0.40%	0.00%	NA
All Japonica	1512	8.30%	91.40%	0.26%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	98.20%	1.80%	0.00%	0.00%	NA
Indica II	465	75.30%	23.90%	0.86%	0.00%	NA
Indica III	913	62.00%	37.50%	0.55%	0.00%	NA
Indica Intermediate	786	76.70%	23.00%	0.25%	0.00%	NA
Temperate Japonica	767	13.30%	86.40%	0.26%	0.00%	NA
Tropical Japonica	504	2.40%	97.60%	0.00%	0.00%	NA
Japonica Intermediate	241	5.00%	94.20%	0.83%	0.00%	NA
VI/Aromatic	96	14.60%	85.40%	0.00%	0.00%	NA
Intermediate	90	38.90%	58.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005689732	G -> A	LOC_Os10g10350.1	downstream_gene_variant ; 466.0bp to feature; MODIFIER	silent_mutation	Average:53.958; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg1005689732	G -> A	LOC_Os10g10360.1	downstream_gene_variant ; 3713.0bp to feature; MODIFIER	silent_mutation	Average:53.958; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg1005689732	G -> A	LOC_Os10g10360.4	downstream_gene_variant ; 3713.0bp to feature; MODIFIER	silent_mutation	Average:53.958; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg1005689732	G -> A	LOC_Os10g10360.3	downstream_gene_variant ; 3713.0bp to feature; MODIFIER	silent_mutation	Average:53.958; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg1005689732	G -> A	LOC_Os10g10360.2	downstream_gene_variant ; 4613.0bp to feature; MODIFIER	silent_mutation	Average:53.958; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg1005689732	G -> A	LOC_Os10g10350-LOC_Os10g10360	intergenic_region ; MODIFIER	silent_mutation	Average:53.958; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005689732	NA	1.38E-11	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	7.23E-06	2.38E-09	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	5.90E-08	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	8.80E-07	3.53E-10	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	3.31E-24	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	1.19E-09	3.44E-21	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	6.03E-08	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	3.55E-07	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	7.96E-11	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	5.06E-07	1.17E-09	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	1.16E-13	mr1239	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	8.58E-08	5.67E-11	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	6.02E-08	2.21E-10	mr1305	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	4.55E-06	4.55E-06	mr1409	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	3.09E-33	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	3.72E-18	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	1.53E-06	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	1.03E-07	3.45E-11	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	7.27E-07	3.80E-09	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	9.33E-06	9.33E-06	mr1670	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	1.06E-09	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	9.02E-06	5.08E-07	mr1917	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	7.35E-09	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	2.15E-09	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	3.26E-08	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	6.11E-24	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	5.18E-08	1.75E-20	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	3.79E-08	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	9.20E-12	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	4.98E-11	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	1.71E-11	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	9.17E-06	NA	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	2.54E-07	2.30E-09	mr1258_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	5.40E-06	5.86E-08	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	1.95E-34	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	4.23E-07	1.72E-19	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	8.21E-06	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	2.87E-07	9.04E-11	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	9.32E-11	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005689732	NA	5.92E-06	mr1961_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251