\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005684375:

Variant ID: vg1005684375 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5684375
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAGAGAATAAGAAGATTGAAGAAAAGCCCAAGTGGGAAGAGAGGTTTGATTCACTCAAGGCAGCTAGAAGAGCCAGAGGTGAATGCTTTAAATGTGGA[G/T]
AGAAATTTGGCCCAAGGCACAAGTGTCCAAAATCTGTGCAACTTTAGGTGCTGGAGGAACTTTTGGAAGTATTTTAAAATCAAGAAGAAGAGTCTACAAT

Reverse complement sequence

ATTGTAGACTCTTCTTCTTGATTTTAAAATACTTCCAAAAGTTCCTCCAGCACCTAAAGTTGCACAGATTTTGGACACTTGTGCCTTGGGCCAAATTTCT[C/A]
TCCACATTTAAAGCATTCACCTCTGGCTCTTCTAGCTGCCTTGAGTGAATCAAACCTCTCTTCCCACTTGGGCTTTTCTTCAATCTTCTTATTCTCTTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.10% 1.30% 0.55% 0.00% NA
All Indica  2759 96.80% 2.30% 0.91% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 89.10% 7.60% 3.36% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 1.90% 0.64% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005684375 G -> T LOC_Os10g10334.1 downstream_gene_variant ; 3273.0bp to feature; MODIFIER silent_mutation Average:50.067; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg1005684375 G -> T LOC_Os10g10350.1 intron_variant ; MODIFIER silent_mutation Average:50.067; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005684375 NA 1.10E-06 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005684375 NA 4.41E-08 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005684375 3.31E-06 4.14E-08 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005684375 NA 2.04E-08 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005684375 NA 5.02E-08 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005684375 NA 2.92E-08 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005684375 6.23E-07 4.10E-10 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005684375 4.46E-08 2.85E-12 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005684375 NA 5.36E-08 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005684375 NA 2.00E-10 mr1180_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005684375 NA 9.26E-10 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005684375 NA 1.86E-08 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005684375 9.04E-08 9.04E-08 mr1250_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005684375 NA 1.35E-06 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251