\
| Variant ID: vg1005678285 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5678285 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 236. )
ATGTGTCATATCCCGTACTAGTTTGTTTTTTATAGGACGGAGGGAGTAAATGATATGTCTCTAGACTGGCGTAGCGTATCCATTTGTTTTGCTGCAAGAG[C/T]
AATACAGTTGTTTAGGTATTGGGTTCTAAGCCGCACATAGGCTGGCTCTTGAACTCCTGTTAGAACTTTATTGGCAAATTTCAGGAGGAGAGCAGTGCGC
GCGCACTGCTCTCCTCCTGAAATTTGCCAATAAAGTTCTAACAGGAGTTCAAGAGCCAGCCTATGTGCGGCTTAGAACCCAATACCTAAACAACTGTATT[G/A]
CTCTTGCAGCAAAACAAATGGATACGCTACGCCAGTCTAGAGACATATCATTTACTCCCTCCGTCCTATAAAAAACAAACTAGTACGGGATATGACACAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.70% | 3.40% | 0.15% | 0.66% | NA |
| All Indica | 2759 | 99.50% | 0.50% | 0.00% | 0.07% | NA |
| All Japonica | 1512 | 92.50% | 7.00% | 0.13% | 0.40% | NA |
| Aus | 269 | 98.50% | 0.00% | 0.00% | 1.49% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 0.90% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 99.40% | 0.50% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 87.00% | 12.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.40% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 95.90% | 2.10% | 0.41% | 1.66% | NA |
| VI/Aromatic | 96 | 39.60% | 39.60% | 4.17% | 16.67% | NA |
| Intermediate | 90 | 88.90% | 6.70% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005678285 | C -> T | LOC_Os10g10334.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.955; most accessible tissue: Callus, score: 70.863 | N | N | N | N |
| vg1005678285 | C -> DEL | N | N | silent_mutation | Average:44.955; most accessible tissue: Callus, score: 70.863 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005678285 | 2.32E-10 | NA | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005678285 | 8.86E-06 | 4.39E-09 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005678285 | 7.43E-11 | NA | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005678285 | 5.82E-06 | 4.45E-09 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005678285 | 2.30E-06 | 3.43E-11 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005678285 | 5.33E-06 | 6.49E-11 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005678285 | 1.58E-10 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005678285 | NA | 4.22E-08 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005678285 | 4.45E-06 | NA | mr1649 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005678285 | NA | 7.03E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005678285 | NA | 1.42E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005678285 | 2.99E-08 | NA | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005678285 | 1.33E-06 | 3.78E-09 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005678285 | 1.02E-06 | 2.09E-11 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005678285 | 2.37E-07 | 9.29E-12 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |