\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005668884:

Variant ID: vg1005668884 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5668884
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CACGGGTGAACAGTATATTATTTTTTGTCATTATTTTTTTAGCGTATTTTCATGCAACGTAACGAATGTAACTATTTGCATGTAGGTACGTAAATATTTC[C/T]
AGTAAACGGATTATCTTGGATATAGAAAGCATAAAATTTTTAAATAGATCTAATCCGACGGTATAGAATAATGGATCCACCAATTTAAATGAAAATCAAT

Reverse complement sequence

ATTGATTTTCATTTAAATTGGTGGATCCATTATTCTATACCGTCGGATTAGATCTATTTAAAAATTTTATGCTTTCTATATCCAAGATAATCCGTTTACT[G/A]
GAAATATTTACGTACCTACATGCAAATAGTTACATTCGTTACGTTGCATGAAAATACGCTAAAAAAATAATGACAAAAAATAATATACTGTTCACCCGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.10% 34.80% 1.12% 0.00% NA
All Indica  2759 51.50% 48.10% 0.33% 0.00% NA
All Japonica  1512 95.80% 1.30% 2.84% 0.00% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 11.10% 88.70% 0.17% 0.00% NA
Indica II  465 54.80% 44.90% 0.22% 0.00% NA
Indica III  913 68.50% 31.10% 0.44% 0.00% NA
Indica Intermediate  786 60.60% 39.10% 0.38% 0.00% NA
Temperate Japonica  767 93.90% 0.70% 5.48% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.50% 0.41% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 73.30% 25.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005668884 C -> T LOC_Os10g10310.1 downstream_gene_variant ; 4348.0bp to feature; MODIFIER silent_mutation Average:38.368; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1005668884 C -> T LOC_Os10g10320.1 downstream_gene_variant ; 1359.0bp to feature; MODIFIER silent_mutation Average:38.368; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1005668884 C -> T LOC_Os10g10310-LOC_Os10g10320 intergenic_region ; MODIFIER silent_mutation Average:38.368; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005668884 NA 3.58E-14 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 1.30E-07 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 5.70E-22 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 3.63E-15 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 2.35E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 2.24E-14 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 1.12E-06 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 6.01E-32 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 2.75E-15 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 2.14E-06 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 1.21E-07 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 7.40E-06 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 7.48E-26 mr1118_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 2.04E-06 1.40E-21 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 5.04E-08 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 5.27E-16 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 7.08E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 3.31E-34 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 4.92E-18 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 4.22E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 1.56E-08 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 2.53E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 1.31E-07 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 8.35E-17 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 3.56E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005668884 NA 5.32E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251