Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005666781:

Variant ID: vg1005666781 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5666781
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTGTAGACATAATTTGTTTGTAGTATTAATCAGTACTACCCGTTTATGGTATAGATACAACATTCTCTTTTGTTAAGTGAGGTTAATCATTAAAAAAAA[G/T,A]
GAGAGAATCTATTCTACACCACTGAGTTTGTTCGAGTTCAACGATTTACCATCAACATTGTCTTTTTTTATAATATACCGGCGACTTTATCAATTGTTCT

Reverse complement sequence

AGAACAATTGATAAAGTCGCCGGTATATTATAAAAAAAGACAATGTTGATGGTAAATCGTTGAACTCGAACAAACTCAGTGGTGTAGAATAGATTCTCTC[C/A,T]
TTTTTTTTAATGATTAACCTCACTTAACAAAAGAGAATGTTGTATCTATACCATAAACGGGTAGTACTGATTAATACTACAAACAAATTATGTCTACACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.30%	27.40%	0.00%	0.25%	A: 0.02%
All Indica	2759	54.20%	45.40%	0.00%	0.43%	NA
All Japonica	1512	98.90%	1.10%	0.00%	0.00%	A: 0.07%
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	13.10%	86.70%	0.00%	0.17%	NA
Indica II	465	55.50%	44.10%	0.00%	0.43%	NA
Indica III	913	70.30%	29.40%	0.00%	0.33%	NA
Indica Intermediate	786	65.60%	33.60%	0.00%	0.76%	NA
Temperate Japonica	767	99.30%	0.70%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.00%	0.00%	0.00%	A: 0.20%
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005666781	G -> T	LOC_Os10g10300.1	upstream_gene_variant ; 4627.0bp to feature; MODIFIER	silent_mutation	Average:32.368; most accessible tissue: Callus, score: 53.42	N	N	N	N
vg1005666781	G -> T	LOC_Os10g10310.1	downstream_gene_variant ; 2245.0bp to feature; MODIFIER	silent_mutation	Average:32.368; most accessible tissue: Callus, score: 53.42	N	N	N	N
vg1005666781	G -> T	LOC_Os10g10320.1	downstream_gene_variant ; 3462.0bp to feature; MODIFIER	silent_mutation	Average:32.368; most accessible tissue: Callus, score: 53.42	N	N	N	N
vg1005666781	G -> T	LOC_Os10g10310-LOC_Os10g10320	intergenic_region ; MODIFIER	silent_mutation	Average:32.368; most accessible tissue: Callus, score: 53.42	N	N	N	N
vg1005666781	G -> A	LOC_Os10g10300.1	upstream_gene_variant ; 4627.0bp to feature; MODIFIER	silent_mutation	Average:32.368; most accessible tissue: Callus, score: 53.42	N	N	N	N
vg1005666781	G -> A	LOC_Os10g10310.1	downstream_gene_variant ; 2245.0bp to feature; MODIFIER	silent_mutation	Average:32.368; most accessible tissue: Callus, score: 53.42	N	N	N	N
vg1005666781	G -> A	LOC_Os10g10320.1	downstream_gene_variant ; 3462.0bp to feature; MODIFIER	silent_mutation	Average:32.368; most accessible tissue: Callus, score: 53.42	N	N	N	N
vg1005666781	G -> A	LOC_Os10g10310-LOC_Os10g10320	intergenic_region ; MODIFIER	silent_mutation	Average:32.368; most accessible tissue: Callus, score: 53.42	N	N	N	N
vg1005666781	G -> DEL	N	N	silent_mutation	Average:32.368; most accessible tissue: Callus, score: 53.42	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005666781	NA	1.17E-41	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	NA	6.94E-20	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	NA	2.75E-06	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	NA	3.09E-15	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	NA	1.02E-06	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	NA	3.51E-40	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	NA	1.44E-19	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	NA	8.42E-06	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	NA	2.23E-14	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	NA	2.43E-06	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	NA	4.05E-06	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	NA	1.13E-06	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	NA	2.54E-19	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	1.53E-09	2.30E-25	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	NA	9.22E-07	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	1.04E-07	1.18E-43	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	1.67E-07	1.18E-22	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	NA	2.04E-06	mr1242_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	NA	1.17E-22	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	9.75E-07	3.35E-20	mr1495_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	NA	9.17E-10	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	NA	9.46E-07	mr1580_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	NA	2.34E-07	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005666781	NA	3.57E-08	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251