\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005659181:

Variant ID: vg1005659181 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5659181
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTAAGTGAAGCGTGAAAAATCATCAACAATGACGAAACCATACTTGTTACCTCCAATGCTTATGTAGGCCACATGCCCAAATAAATCCATATGAAGAA[G/A]
CTCGAGTGGTCTTGTTGTAGTCATGATATTTTTTATAGGATGTGGACTCCCAACTTGCTTCCCGGCTTGGCAAGCACTACACACACGATCTTTCTCAAAA

Reverse complement sequence

TTTTGAGAAAGATCGTGTGTGTAGTGCTTGCCAAGCCGGGAAGCAAGTTGGGAGTCCACATCCTATAAAAAATATCATGACTACAACAAGACCACTCGAG[C/T]
TTCTTCATATGGATTTATTTGGGCATGTGGCCTACATAAGCATTGGAGGTAACAAGTATGGTTTCGTCATTGTTGATGATTTTTCACGCTTCACTTAGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.60% 2.50% 4.59% 8.29% NA
All Indica  2759 74.30% 4.00% 7.68% 13.99% NA
All Japonica  1512 99.50% 0.20% 0.13% 0.20% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 91.10% 1.20% 1.68% 6.05% NA
Indica II  465 71.20% 3.90% 10.54% 14.41% NA
Indica III  913 71.20% 2.80% 8.11% 17.85% NA
Indica Intermediate  786 67.20% 7.50% 10.05% 15.27% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 97.90% 1.20% 0.83% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 90.00% 3.30% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005659181 G -> A LOC_Os10g10300.1 missense_variant ; p.Leu700Phe; MODERATE nonsynonymous_codon ; L700F Average:41.706; most accessible tissue: Minghui63 flag leaf, score: 63.086 probably damaging 2.145 DELETERIOUS 0.01
vg1005659181 G -> DEL LOC_Os10g10300.1 N frameshift_variant Average:41.706; most accessible tissue: Minghui63 flag leaf, score: 63.086 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005659181 NA 4.06E-08 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005659181 NA 1.50E-06 mr1046_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005659181 3.12E-06 3.12E-06 mr1048_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005659181 NA 2.98E-07 mr1057_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005659181 NA 6.13E-06 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005659181 NA 8.91E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005659181 NA 1.48E-06 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005659181 NA 4.23E-06 mr1288_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005659181 NA 5.81E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005659181 NA 2.65E-06 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005659181 NA 4.37E-09 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005659181 NA 5.03E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005659181 7.12E-06 1.26E-10 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005659181 8.31E-06 8.31E-06 mr1941_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005659181 NA 6.65E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005659181 NA 4.05E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251