\
| Variant ID: vg1005659155 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5659155 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 204. )
CTTCGCTTTTGTCATGGAGAAAGTACACCTAAGTGAAGCGTGAAAAATCATCAACAATGACGAAACCATACTTGTTACCTCCAATGCTTATGTAGGCCAC[A/G]
TGCCCAAATAAATCCATATGAAGAAGCTCGAGTGGTCTTGTTGTAGTCATGATATTTTTTATAGGATGTGGACTCCCAACTTGCTTCCCGGCTTGGCAAG
CTTGCCAAGCCGGGAAGCAAGTTGGGAGTCCACATCCTATAAAAAATATCATGACTACAACAAGACCACTCGAGCTTCTTCATATGGATTTATTTGGGCA[T/C]
GTGGCCTACATAAGCATTGGAGGTAACAAGTATGGTTTCGTCATTGTTGATGATTTTTCACGCTTCACTTAGGTGTACTTTCTCCATGACAAAAGCGAAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.00% | 19.60% | 0.47% | 0.00% | NA |
| All Indica | 2759 | 73.50% | 25.70% | 0.80% | 0.00% | NA |
| All Japonica | 1512 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 71.20% | 27.30% | 1.51% | 0.00% | NA |
| Indica III | 913 | 69.40% | 29.60% | 0.99% | 0.00% | NA |
| Indica Intermediate | 786 | 66.40% | 32.80% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 92.30% | 7.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 58.30% | 41.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005659155 | A -> G | LOC_Os10g10300.1 | synonymous_variant ; p.His708His; LOW | synonymous_codon | Average:37.344; most accessible tissue: Minghui63 flag leaf, score: 56.489 | N | N | N | N |
| vg1005659155 | A -> G | LOC_Os10g10300.1 | synonymous_variant ; p.His708His; LOW | nonsynonymous_codon ; H708P | Average:37.344; most accessible tissue: Minghui63 flag leaf, score: 56.489 | probably damaging |
-3.205 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005659155 | NA | 5.79E-07 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005659155 | NA | 6.92E-07 | mr1580_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005659155 | NA | 9.36E-06 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005659155 | NA | 3.01E-06 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005659155 | NA | 9.64E-09 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005659155 | NA | 4.31E-06 | mr1915_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005659155 | 1.85E-06 | 1.85E-06 | mr1940_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005659155 | NA | 2.91E-07 | mr1943_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |