\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005619377:

Variant ID: vg1005619377 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5619377
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGGTATCTTGCAACAAGGTCGGCCAGTAAAAACCTTGTCAGAAAGCGTTACCGACCAATGTGCGTGAGGCCGAATGGGCCCCACACTCACCCTGATGAG[C/T]
GTCGGCGATGAGCTTGACGCCTTGCTCCCAAAAAATACACTTCAAGAGTATCCCATTGGCGGCACTCCGGTAGAGGGTCCATTCTACGAGCACGTGCCGC

Reverse complement sequence

GCGGCACGTGCTCGTAGAATGGACCCTCTACCGGAGTGCCGCCAATGGGATACTCTTGAAGTGTATTTTTTGGGAGCAAGGCGTCAAGCTCATCGCCGAC[G/A]
CTCATCAGGGTGAGTGTGGGGCCCATTCGGCCTCACGCACATTGGTCGGTAACGCTTTCTGACAAGGTTTTTACTGGCCGACCTTGTTGCAAGATACCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.10% 2.50% 0.59% 5.84% NA
All Indica  2759 97.80% 0.00% 0.07% 2.10% NA
All Japonica  1512 91.00% 7.60% 1.06% 0.33% NA
Aus  269 18.20% 0.00% 3.72% 78.07% NA
Indica I  595 98.50% 0.00% 0.00% 1.51% NA
Indica II  465 99.10% 0.00% 0.00% 0.86% NA
Indica III  913 98.20% 0.10% 0.11% 1.53% NA
Indica Intermediate  786 95.90% 0.00% 0.13% 3.94% NA
Temperate Japonica  767 84.40% 14.00% 1.69% 0.00% NA
Tropical Japonica  504 98.60% 0.40% 0.00% 0.99% NA
Japonica Intermediate  241 96.30% 2.50% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 2.20% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005619377 C -> T LOC_Os10g10214.1 missense_variant ; p.Ala875Thr; MODERATE nonsynonymous_codon ; A875T Average:62.339; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 benign 0.135 DELETERIOUS 0.05
vg1005619377 C -> DEL LOC_Os10g10214.1 N frameshift_variant Average:62.339; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005619377 3.45E-07 5.04E-11 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005619377 3.08E-07 6.93E-11 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005619377 3.99E-07 1.10E-12 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005619377 5.77E-06 1.69E-09 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005619377 NA 1.51E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005619377 NA 6.51E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005619377 7.49E-09 1.23E-11 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005619377 NA 2.56E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005619377 2.11E-06 4.08E-06 mr1559_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005619377 4.77E-09 3.97E-14 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005619377 NA 6.12E-07 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251