Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005619377:

Variant ID: vg1005619377 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5619377
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGGTATCTTGCAACAAGGTCGGCCAGTAAAAACCTTGTCAGAAAGCGTTACCGACCAATGTGCGTGAGGCCGAATGGGCCCCACACTCACCCTGATGAG[C/T]
GTCGGCGATGAGCTTGACGCCTTGCTCCCAAAAAATACACTTCAAGAGTATCCCATTGGCGGCACTCCGGTAGAGGGTCCATTCTACGAGCACGTGCCGC

Reverse complement sequence

GCGGCACGTGCTCGTAGAATGGACCCTCTACCGGAGTGCCGCCAATGGGATACTCTTGAAGTGTATTTTTTGGGAGCAAGGCGTCAAGCTCATCGCCGAC[G/A]
CTCATCAGGGTGAGTGTGGGGCCCATTCGGCCTCACGCACATTGGTCGGTAACGCTTTCTGACAAGGTTTTTACTGGCCGACCTTGTTGCAAGATACCCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.10%	2.50%	0.59%	5.84%	NA
All Indica	2759	97.80%	0.00%	0.07%	2.10%	NA
All Japonica	1512	91.00%	7.60%	1.06%	0.33%	NA
Aus	269	18.20%	0.00%	3.72%	78.07%	NA
Indica I	595	98.50%	0.00%	0.00%	1.51%	NA
Indica II	465	99.10%	0.00%	0.00%	0.86%	NA
Indica III	913	98.20%	0.10%	0.11%	1.53%	NA
Indica Intermediate	786	95.90%	0.00%	0.13%	3.94%	NA
Temperate Japonica	767	84.40%	14.00%	1.69%	0.00%	NA
Tropical Japonica	504	98.60%	0.40%	0.00%	0.99%	NA
Japonica Intermediate	241	96.30%	2.50%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	2.20%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005619377	C -> T	LOC_Os10g10214.1	missense_variant ; p.Ala875Thr; MODERATE	nonsynonymous_codon ; A875T	Average:62.339; most accessible tissue: Zhenshan97 flag leaf, score: 79.935	benign	0.135	DELETERIOUS	0.05
vg1005619377	C -> DEL	LOC_Os10g10214.1	N	frameshift_variant	Average:62.339; most accessible tissue: Zhenshan97 flag leaf, score: 79.935	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005619377	3.45E-07	5.04E-11	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005619377	3.08E-07	6.93E-11	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005619377	3.99E-07	1.10E-12	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005619377	5.77E-06	1.69E-09	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005619377	NA	1.51E-06	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005619377	NA	6.51E-06	mr1922	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005619377	7.49E-09	1.23E-11	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005619377	NA	2.56E-06	mr1409_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005619377	2.11E-06	4.08E-06	mr1559_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005619377	4.77E-09	3.97E-14	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005619377	NA	6.12E-07	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251