\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005588645:

Variant ID: vg1005588645 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5588645
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, A: 0.23, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CAGTCCGCCTTTAGGCTCCAGCGCCTGCCGCCTGATCAAGTGATCGCCATCGGCCAAGGCGGCATTGCTACCTCCTGCCTGGCTACCTGTAGCCTGCATC[A/G]
AGTCATCATCTCTCCTCTACAGATTGTCTGACACTTCGACTCCAGCGCTCCTGATTCCTGAAGGTAGGTCATAAATAATAAATAATAGAAGTTCCTCTAT

Reverse complement sequence

ATAGAGGAACTTCTATTATTTATTATTTATGACCTACCTTCAGGAATCAGGAGCGCTGGAGTCGAAGTGTCAGACAATCTGTAGAGGAGAGATGATGACT[T/C]
GATGCAGGCTACAGGTAGCCAGGCAGGAGGTAGCAATGCCGCCTTGGCCGATGGCGATCACTTGATCAGGCGGCAGGCGCTGGAGCCTAAAGGCGGACTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.80% 47.80% 0.15% 0.25% NA
All Indica  2759 25.20% 74.40% 0.11% 0.36% NA
All Japonica  1512 91.60% 8.30% 0.07% 0.07% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 2.70% 97.30% 0.00% 0.00% NA
Indica II  465 23.40% 75.50% 0.22% 0.86% NA
Indica III  913 38.70% 60.90% 0.11% 0.33% NA
Indica Intermediate  786 27.50% 72.00% 0.13% 0.38% NA
Temperate Japonica  767 86.80% 13.20% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 92.10% 7.10% 0.41% 0.41% NA
VI/Aromatic  96 50.00% 49.00% 1.04% 0.00% NA
Intermediate  90 58.90% 37.80% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005588645 A -> G LOC_Os10g10170.1 upstream_gene_variant ; 3096.0bp to feature; MODIFIER silent_mutation Average:65.188; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N
vg1005588645 A -> G LOC_Os10g10175.1 upstream_gene_variant ; 2039.0bp to feature; MODIFIER silent_mutation Average:65.188; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N
vg1005588645 A -> G LOC_Os10g10180.1 upstream_gene_variant ; 4257.0bp to feature; MODIFIER silent_mutation Average:65.188; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N
vg1005588645 A -> G LOC_Os10g10170.2 upstream_gene_variant ; 3703.0bp to feature; MODIFIER silent_mutation Average:65.188; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N
vg1005588645 A -> G LOC_Os10g10170.4 upstream_gene_variant ; 3703.0bp to feature; MODIFIER silent_mutation Average:65.188; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N
vg1005588645 A -> G LOC_Os10g10180.3 upstream_gene_variant ; 4257.0bp to feature; MODIFIER silent_mutation Average:65.188; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N
vg1005588645 A -> G LOC_Os10g10175-LOC_Os10g10180 intergenic_region ; MODIFIER silent_mutation Average:65.188; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N
vg1005588645 A -> DEL N N silent_mutation Average:65.188; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005588645 3.31E-06 2.48E-40 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 9.35E-06 1.39E-13 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 NA 9.61E-07 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 NA 1.18E-06 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 1.00E-06 5.67E-14 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 NA 1.14E-37 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 NA 4.81E-12 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 4.38E-06 8.84E-09 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 NA 4.10E-06 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 NA 5.99E-18 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 NA 4.16E-07 mr1261 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 9.33E-07 2.08E-09 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 8.39E-07 4.72E-17 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 NA 7.84E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 1.75E-06 5.38E-10 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 NA 8.55E-08 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 6.31E-06 6.31E-06 mr1649 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 1.57E-06 NA mr1922 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 NA 4.52E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 4.77E-06 NA mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 NA 7.19E-07 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 NA 1.35E-07 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 2.18E-08 1.43E-16 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 NA 3.36E-08 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 4.79E-06 1.73E-39 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 NA 2.44E-12 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 NA 1.67E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 NA 1.97E-07 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 1.30E-07 3.75E-17 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 2.84E-06 1.37E-09 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005588645 NA 7.02E-06 mr1913_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251