Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005570850:

Variant ID: vg1005570850 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5570850
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, G: 0.18, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:


GTCGGGCCGGGCCGGCACGGGCCCGACCCAAGTCGGGTCGTGCCGTGCTTGGGCCGGGCCAAAAAGGCGTGACGTGGGCCGGGCCTTCGGGCCTCGGGCC[G/T]
TATGGCCAACTATAGGCTGAGTTATGTGTGGGTCCCACAATGGCTTGGTCTCACATGTAAGAAAGAGATGTAGAAGGAGAGACCTAGAAGCTCTAACTTT

Reverse complement sequence

AAAGTTAGAGCTTCTAGGTCTCTCCTTCTACATCTCTTTCTTACATGTGAGACCAAGCCATTGTGGGACCCACACATAACTCAGCCTATAGTTGGCCATA[C/A]
GGCCCGAGGCCCGAAGGCCCGGCCCACGTCACGCCTTTTTGGCCCGGCCCAAGCACGGCACGACCCGACTTGGGTCGGGCCCGTGCCGGCCCGGCCCGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 19.90% 0.32% 26.58% NA
All Indica  2759 51.90% 28.20% 0.29% 19.61% NA
All Japonica  1512 63.70% 6.50% 0.26% 29.50% NA
Aus  269 12.60% 1.10% 0.00% 86.25% NA
Indica I  595 86.90% 11.60% 0.00% 1.51% NA
Indica II  465 51.00% 30.80% 0.22% 18.06% NA
Indica III  913 32.00% 36.70% 0.44% 30.89% NA
Indica Intermediate  786 49.00% 29.50% 0.38% 21.12% NA
Temperate Japonica  767 74.10% 9.50% 0.39% 16.04% NA
Tropical Japonica  504 52.80% 0.60% 0.20% 46.43% NA
Japonica Intermediate  241 53.50% 9.50% 0.00% 36.93% NA
VI/Aromatic  96 34.40% 45.80% 0.00% 19.79% NA
Intermediate  90 60.00% 16.70% 3.33% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005570850 G -> T LOC_Os10g10149.1 upstream_gene_variant ; 926.0bp to feature; MODIFIER silent_mutation Average:62.793; most accessible tissue: Zhenshan97 young leaf, score: 98.614 N N N N
vg1005570850 G -> T LOC_Os10g10160.1 upstream_gene_variant ; 40.0bp to feature; MODIFIER silent_mutation Average:62.793; most accessible tissue: Zhenshan97 young leaf, score: 98.614 N N N N
vg1005570850 G -> T LOC_Os10g10149-LOC_Os10g10160 intergenic_region ; MODIFIER silent_mutation Average:62.793; most accessible tissue: Zhenshan97 young leaf, score: 98.614 N N N N
vg1005570850 G -> DEL N N silent_mutation Average:62.793; most accessible tissue: Zhenshan97 young leaf, score: 98.614 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1005570850 G T 0.01 0.0 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005570850 NA 5.75E-07 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005570850 NA 2.45E-07 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005570850 NA 8.02E-07 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005570850 NA 8.26E-06 mr1728_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005570850 NA 9.23E-09 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251