\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005564884:

Variant ID: vg1005564884 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5564884
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.18, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


TGCAATAGGATATTGCATCGGATCGGTAATTGCAATGTCTCGCAATGAAAATATTACATTGCGAGTTCTCCATATTGCAACGAAAATACCCTTATTGCAA[T/C]
GTTTTCGCGTCGTTGTGCTTGGGCAAAATCCTTGTAGTGTCCACCACCACCACCGAGGCCTCCATTCATGCATTCGTCTCTCGCTCACGATTTCTTGAGC

Reverse complement sequence

GCTCAAGAAATCGTGAGCGAGAGACGAATGCATGAATGGAGGCCTCGGTGGTGGTGGTGGACACTACAAGGATTTTGCCCAAGCACAACGACGCGAAAAC[A/G]
TTGCAATAAGGGTATTTTCGTTGCAATATGGAGAACTCGCAATGTAATATTTTCATTGCGAGACATTGCAATTACCGATCCGATGCAATATCCTATTGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.40% 35.00% 0.53% 26.07% NA
All Indica  2759 28.20% 52.10% 0.36% 19.32% NA
All Japonica  1512 61.60% 8.90% 0.60% 28.97% NA
Aus  269 9.70% 4.50% 1.86% 84.01% NA
Indica I  595 12.10% 86.60% 0.00% 1.34% NA
Indica II  465 32.00% 49.70% 0.00% 18.28% NA
Indica III  913 34.30% 34.50% 0.55% 30.67% NA
Indica Intermediate  786 31.20% 47.80% 0.64% 20.36% NA
Temperate Japonica  767 72.20% 11.50% 0.65% 15.65% NA
Tropical Japonica  504 50.80% 2.80% 0.60% 45.83% NA
Japonica Intermediate  241 50.20% 13.30% 0.41% 36.10% NA
VI/Aromatic  96 36.50% 44.80% 1.04% 17.71% NA
Intermediate  90 48.90% 31.10% 0.00% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005564884 T -> C LOC_Os10g10140.1 downstream_gene_variant ; 988.0bp to feature; MODIFIER silent_mutation Average:23.228; most accessible tissue: Callus, score: 45.268 N N N N
vg1005564884 T -> C LOC_Os10g10149.1 downstream_gene_variant ; 3940.0bp to feature; MODIFIER silent_mutation Average:23.228; most accessible tissue: Callus, score: 45.268 N N N N
vg1005564884 T -> C LOC_Os10g10140-LOC_Os10g10149 intergenic_region ; MODIFIER silent_mutation Average:23.228; most accessible tissue: Callus, score: 45.268 N N N N
vg1005564884 T -> DEL N N silent_mutation Average:23.228; most accessible tissue: Callus, score: 45.268 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005564884 NA 7.79E-06 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005564884 5.94E-07 5.94E-07 mr1281_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005564884 NA 1.87E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005564884 NA 6.25E-06 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005564884 NA 2.97E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005564884 6.04E-06 6.04E-06 mr1940_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251