\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005564150:

Variant ID: vg1005564150 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5564150
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, C: 0.11, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


AATTGTTATTTGAACGGGCTGTAAGAGTGAATGATTGTTTGATTCCTCAAATTTTTTAATATAAATGTGTTGCACCAATTTTTGATGTGGAATATTTCTG[T/C]
TGTAGTAACCAAATAAATCAGTGTTACAATATTGCACAATTTGTTATGCTATCCTTTAAGCGTGTAGCGATGACCCATATTTTGTTGCGATATGGTTTAA

Reverse complement sequence

TTAAACCATATCGCAACAAAATATGGGTCATCGCTACACGCTTAAAGGATAGCATAACAAATTGTGCAATATTGTAACACTGATTTATTTGGTTACTACA[A/G]
CAGAAATATTCCACATCAAAAATTGGTGCAACACATTTATATTAAAAAATTTGAGGAATCAAACAATCATTCACTCTTACAGCCCGTTCAAATAACAATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 30.10% 3.77% 1.78% NA
All Indica  2759 42.80% 49.40% 4.89% 2.86% NA
All Japonica  1512 95.90% 1.90% 1.92% 0.26% NA
Aus  269 94.80% 1.50% 3.35% 0.37% NA
Indica I  595 13.40% 86.40% 0.17% 0.00% NA
Indica II  465 46.50% 48.40% 4.73% 0.43% NA
Indica III  913 55.30% 29.60% 7.78% 7.34% NA
Indica Intermediate  786 48.30% 45.20% 5.22% 1.27% NA
Temperate Japonica  767 97.10% 1.70% 0.91% 0.26% NA
Tropical Japonica  504 96.80% 1.20% 1.98% 0.00% NA
Japonica Intermediate  241 90.00% 4.10% 4.98% 0.83% NA
VI/Aromatic  96 91.70% 7.30% 1.04% 0.00% NA
Intermediate  90 73.30% 22.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005564150 T -> C LOC_Os10g10140.1 downstream_gene_variant ; 254.0bp to feature; MODIFIER silent_mutation Average:22.128; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 N N N N
vg1005564150 T -> C LOC_Os10g10149.1 downstream_gene_variant ; 4674.0bp to feature; MODIFIER silent_mutation Average:22.128; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 N N N N
vg1005564150 T -> C LOC_Os10g10140-LOC_Os10g10149 intergenic_region ; MODIFIER silent_mutation Average:22.128; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 N N N N
vg1005564150 T -> DEL N N silent_mutation Average:22.128; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005564150 NA 6.69E-07 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005564150 8.21E-07 8.21E-07 mr1281_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005564150 NA 3.65E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005564150 NA 8.18E-11 mr1940_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005564150 4.64E-06 4.64E-06 mr1940_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251