Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005555827:

Variant ID: vg1005555827 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5555827
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTGCCAACTTGCTGTTTTCGTTTGCGAGACGCCGAGAAGTCACTGAGAGCGCAGGAGCAACGAACGGCGTGACGTGATTGAGGCGGCACGACGTGAGT[G/A]
GCGTGATGTGATCAAGGCAAAGCGACGGGAGTCAAATAAAGATTGCTTCGGCTTCGCTAAAACAGGCCTAACGATGGACTAAAATTCATTTTCTGTATTA

Reverse complement sequence

TAATACAGAAAATGAATTTTAGTCCATCGTTAGGCCTGTTTTAGCGAAGCCGAAGCAATCTTTATTTGACTCCCGTCGCTTTGCCTTGATCACATCACGC[C/T]
ACTCACGTCGTGCCGCCTCAATCACGTCACGCCGTTCGTTGCTCCTGCGCTCTCAGTGACTTCTCGGCGTCTCGCAAACGAAAACAGCAAGTTGGCAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.00%	35.70%	9.44%	8.87%	NA
All Indica	2759	29.20%	58.40%	7.72%	4.64%	NA
All Japonica	1512	68.90%	3.00%	12.17%	15.94%	NA
Aus	269	68.00%	1.90%	15.24%	14.87%	NA
Indica I	595	9.40%	89.40%	1.18%	0.00%	NA
Indica II	465	13.80%	73.30%	8.39%	4.52%	NA
Indica III	913	47.20%	33.70%	11.94%	7.12%	NA
Indica Intermediate	786	32.40%	54.80%	7.38%	5.34%	NA
Temperate Japonica	767	76.80%	2.90%	11.34%	9.00%	NA
Tropical Japonica	504	58.70%	2.00%	14.48%	24.80%	NA
Japonica Intermediate	241	65.10%	5.40%	9.96%	19.50%	NA
VI/Aromatic	96	93.80%	1.00%	2.08%	3.12%	NA
Intermediate	90	56.70%	28.90%	6.67%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005555827	G -> A	LOC_Os10g10140.1	upstream_gene_variant ; 2777.0bp to feature; MODIFIER	silent_mutation	Average:38.161; most accessible tissue: Zhenshan97 flag leaf, score: 70.007	N	N	N	N
vg1005555827	G -> A	LOC_Os10g10130-LOC_Os10g10140	intergenic_region ; MODIFIER	silent_mutation	Average:38.161; most accessible tissue: Zhenshan97 flag leaf, score: 70.007	N	N	N	N
vg1005555827	G -> DEL	N	N	silent_mutation	Average:38.161; most accessible tissue: Zhenshan97 flag leaf, score: 70.007	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005555827	NA	4.49E-10	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005555827	1.40E-07	4.17E-16	mr1118_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005555827	NA	2.19E-34	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005555827	NA	5.50E-10	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005555827	NA	2.44E-06	mr1242_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005555827	NA	1.50E-07	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005555827	NA	9.85E-07	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251