RiceVarMap2

Detailed information for vg1005555783:

Variant ID: vg1005555783 (JBrowse)

Variation Type: SNP

Chromosome: chr10

Position: 5555783

Reference Allele: G

Alternative Allele: T

Primary Allele: G

Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.03, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:

GACCGGCGGACGATTGACACGAGCGTGGTTACTGGCGAATCGCGATTTGCCAACTTGCTGTTTTCGTTTGCGAGACGCCGAGAAGTCACTGAGAGCGCAG[G/T]
AGCAACGAACGGCGTGACGTGATTGAGGCGGCACGACGTGAGTGGCGTGATGTGATCAAGGCAAAGCGACGGGAGTCAAATAAAGATTGCTTCGGCTTCG

Reverse complement sequence

CGAAGCCGAAGCAATCTTTATTTGACTCCCGTCGCTTTGCCTTGATCACATCACGCCACTCACGTCGTGCCGCCTCAATCACGTCACGCCGTTCGTTGCT[C/A]
CTGCGCTCTCAGTGACTTCTCGGCGTCTCGCAAACGAAAACAGCAAGTTGGCAAATCGCGATTCGCCAGTAACCACGCTCGTGTCAATCGTCCGCCGGTC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.80%	10.20%	0.83%	26.09%	NA
All Indica	2759	64.20%	16.80%	0.43%	18.59%	NA
All Japonica	1512	67.30%	0.70%	1.72%	30.29%	NA
Aus	269	15.60%	0.40%	0.37%	83.64%	NA
Indica I	595	90.90%	8.20%	0.00%	0.84%	NA
Indica II	465	77.00%	5.80%	0.22%	16.99%	NA
Indica III	913	42.50%	26.90%	0.55%	30.01%	NA
Indica Intermediate	786	61.50%	18.10%	0.76%	19.72%	NA
Temperate Japonica	767	77.40%	0.40%	3.26%	18.90%	NA
Tropical Japonica	504	54.20%	0.20%	0.20%	45.44%	NA
Japonica Intermediate	241	62.70%	2.50%	0.00%	34.85%	NA
VI/Aromatic	96	78.10%	2.10%	0.00%	19.79%	NA
Intermediate	90	72.20%	7.80%	0.00%	20.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005555783	G -> T	LOC_Os10g10140.1	upstream_gene_variant ; 2821.0bp to feature; MODIFIER	silent_mutation	Average:37.726; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg1005555783	G -> T	LOC_Os10g10130-LOC_Os10g10140	intergenic_region ; MODIFIER	silent_mutation	Average:37.726; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg1005555783	G -> DEL	N	N	silent_mutation	Average:37.726; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005555783	3.63E-06	NA	mr1026	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005555783	1.34E-06	NA	mr1026	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg1005555783:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact