\
| Variant ID: vg1005547004 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5547004 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, T: 0.09, others allele: 0.00, population size: 81. )
TGACTTGATTTGTTTTGTTATTTCGAATTTGCTATAATTTGTATATTACCATATGTATGTGTTAGAAACAAACACAAAAATAGGAAACTAGCTTTACCAA[A/T]
CAAAAATTTGTGTCCAGTTCCCATGGATGACTGACTAATTCCTAGCTAAATATCAAACAAAAATAAGCAATCACCTTAACCTCCAGCAGATTAAAGTACA
TGTACTTTAATCTGCTGGAGGTTAAGGTGATTGCTTATTTTTGTTTGATATTTAGCTAGGAATTAGTCAGTCATCCATGGGAACTGGACACAAATTTTTG[T/A]
TTGGTAAAGCTAGTTTCCTATTTTTGTGTTTGTTTCTAACACATACATATGGTAATATACAAATTATAGCAAATTCGAAATAACAAAACAAATCAAGTCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.50% | 36.10% | 0.25% | 26.13% | NA |
| All Indica | 2759 | 21.70% | 58.80% | 0.14% | 19.39% | NA |
| All Japonica | 1512 | 68.30% | 3.00% | 0.26% | 28.44% | NA |
| Aus | 269 | 8.20% | 3.30% | 1.49% | 86.99% | NA |
| Indica I | 595 | 9.40% | 89.60% | 0.17% | 0.84% | NA |
| Indica II | 465 | 8.60% | 73.50% | 0.22% | 17.63% | NA |
| Indica III | 913 | 34.70% | 33.80% | 0.22% | 31.22% | NA |
| Indica Intermediate | 786 | 23.70% | 55.60% | 0.00% | 20.74% | NA |
| Temperate Japonica | 767 | 81.90% | 2.50% | 0.26% | 15.38% | NA |
| Tropical Japonica | 504 | 52.00% | 2.20% | 0.20% | 45.63% | NA |
| Japonica Intermediate | 241 | 59.30% | 6.20% | 0.41% | 34.02% | NA |
| VI/Aromatic | 96 | 74.00% | 8.30% | 0.00% | 17.71% | NA |
| Intermediate | 90 | 51.10% | 27.80% | 0.00% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005547004 | A -> T | LOC_Os10g10130.1 | upstream_gene_variant ; 2424.0bp to feature; MODIFIER | silent_mutation | Average:27.639; most accessible tissue: Callus, score: 70.923 | N | N | N | N |
| vg1005547004 | A -> T | LOC_Os10g10130.4 | upstream_gene_variant ; 4604.0bp to feature; MODIFIER | silent_mutation | Average:27.639; most accessible tissue: Callus, score: 70.923 | N | N | N | N |
| vg1005547004 | A -> T | LOC_Os10g10130.3 | upstream_gene_variant ; 2426.0bp to feature; MODIFIER | silent_mutation | Average:27.639; most accessible tissue: Callus, score: 70.923 | N | N | N | N |
| vg1005547004 | A -> T | LOC_Os10g10130.2 | upstream_gene_variant ; 2424.0bp to feature; MODIFIER | silent_mutation | Average:27.639; most accessible tissue: Callus, score: 70.923 | N | N | N | N |
| vg1005547004 | A -> T | LOC_Os10g10130.5 | upstream_gene_variant ; 2424.0bp to feature; MODIFIER | silent_mutation | Average:27.639; most accessible tissue: Callus, score: 70.923 | N | N | N | N |
| vg1005547004 | A -> T | LOC_Os10g10130-LOC_Os10g10140 | intergenic_region ; MODIFIER | silent_mutation | Average:27.639; most accessible tissue: Callus, score: 70.923 | N | N | N | N |
| vg1005547004 | A -> DEL | N | N | silent_mutation | Average:27.639; most accessible tissue: Callus, score: 70.923 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005547004 | 9.16E-06 | 2.98E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005547004 | 1.15E-07 | 1.15E-07 | mr1409 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005547004 | NA | 1.80E-12 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005547004 | NA | 2.86E-09 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005547004 | NA | 1.74E-06 | mr1496_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005547004 | NA | 4.17E-06 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |