\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005547004:

Variant ID: vg1005547004 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5547004
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, T: 0.09, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


TGACTTGATTTGTTTTGTTATTTCGAATTTGCTATAATTTGTATATTACCATATGTATGTGTTAGAAACAAACACAAAAATAGGAAACTAGCTTTACCAA[A/T]
CAAAAATTTGTGTCCAGTTCCCATGGATGACTGACTAATTCCTAGCTAAATATCAAACAAAAATAAGCAATCACCTTAACCTCCAGCAGATTAAAGTACA

Reverse complement sequence

TGTACTTTAATCTGCTGGAGGTTAAGGTGATTGCTTATTTTTGTTTGATATTTAGCTAGGAATTAGTCAGTCATCCATGGGAACTGGACACAAATTTTTG[T/A]
TTGGTAAAGCTAGTTTCCTATTTTTGTGTTTGTTTCTAACACATACATATGGTAATATACAAATTATAGCAAATTCGAAATAACAAAACAAATCAAGTCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.50% 36.10% 0.25% 26.13% NA
All Indica  2759 21.70% 58.80% 0.14% 19.39% NA
All Japonica  1512 68.30% 3.00% 0.26% 28.44% NA
Aus  269 8.20% 3.30% 1.49% 86.99% NA
Indica I  595 9.40% 89.60% 0.17% 0.84% NA
Indica II  465 8.60% 73.50% 0.22% 17.63% NA
Indica III  913 34.70% 33.80% 0.22% 31.22% NA
Indica Intermediate  786 23.70% 55.60% 0.00% 20.74% NA
Temperate Japonica  767 81.90% 2.50% 0.26% 15.38% NA
Tropical Japonica  504 52.00% 2.20% 0.20% 45.63% NA
Japonica Intermediate  241 59.30% 6.20% 0.41% 34.02% NA
VI/Aromatic  96 74.00% 8.30% 0.00% 17.71% NA
Intermediate  90 51.10% 27.80% 0.00% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005547004 A -> T LOC_Os10g10130.1 upstream_gene_variant ; 2424.0bp to feature; MODIFIER silent_mutation Average:27.639; most accessible tissue: Callus, score: 70.923 N N N N
vg1005547004 A -> T LOC_Os10g10130.4 upstream_gene_variant ; 4604.0bp to feature; MODIFIER silent_mutation Average:27.639; most accessible tissue: Callus, score: 70.923 N N N N
vg1005547004 A -> T LOC_Os10g10130.3 upstream_gene_variant ; 2426.0bp to feature; MODIFIER silent_mutation Average:27.639; most accessible tissue: Callus, score: 70.923 N N N N
vg1005547004 A -> T LOC_Os10g10130.2 upstream_gene_variant ; 2424.0bp to feature; MODIFIER silent_mutation Average:27.639; most accessible tissue: Callus, score: 70.923 N N N N
vg1005547004 A -> T LOC_Os10g10130.5 upstream_gene_variant ; 2424.0bp to feature; MODIFIER silent_mutation Average:27.639; most accessible tissue: Callus, score: 70.923 N N N N
vg1005547004 A -> T LOC_Os10g10130-LOC_Os10g10140 intergenic_region ; MODIFIER silent_mutation Average:27.639; most accessible tissue: Callus, score: 70.923 N N N N
vg1005547004 A -> DEL N N silent_mutation Average:27.639; most accessible tissue: Callus, score: 70.923 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005547004 9.16E-06 2.98E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005547004 1.15E-07 1.15E-07 mr1409 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005547004 NA 1.80E-12 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005547004 NA 2.86E-09 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005547004 NA 1.74E-06 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005547004 NA 4.17E-06 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251