\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005529461:

Variant ID: vg1005529461 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5529461
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTGGAGGTGTTCATTCTCCGACATCTGGCGCGCCAGGTAAGGGGTGCGTTCGTGATTTTTGAGGTTCTTTCGAGCGCCGGCGCGACGAGCGTCGCACCG[C/T]
CGATGCGGGGGAAGGCGCAGCCTCCTCAGGAGAGCCGCGCCACCCCAGGCAGGGGGCTAGGCCCCCCACATCCTCATCGGAAAAGGCTAGTGGCCAGGCC

Reverse complement sequence

GGCCTGGCCACTAGCCTTTTCCGATGAGGATGTGGGGGGCCTAGCCCCCTGCCTGGGGTGGCGCGGCTCTCCTGAGGAGGCTGCGCCTTCCCCCGCATCG[G/A]
CGGTGCGACGCTCGTCGCGCCGGCGCTCGAAAGAACCTCAAAAATCACGAACGCACCCCTTACCTGGCGCGCCAGATGTCGGAGAATGAACACCTCCACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.30% 4.60% 3.89% 16.19% NA
All Indica  2759 82.60% 0.50% 4.46% 12.47% NA
All Japonica  1512 72.90% 0.10% 1.19% 25.86% NA
Aus  269 9.70% 73.60% 11.90% 4.83% NA
Indica I  595 99.30% 0.00% 0.17% 0.50% NA
Indica II  465 84.90% 0.20% 6.02% 8.82% NA
Indica III  913 71.10% 0.30% 6.57% 22.02% NA
Indica Intermediate  786 81.80% 1.30% 4.33% 12.60% NA
Temperate Japonica  767 85.40% 0.00% 0.65% 13.95% NA
Tropical Japonica  504 56.90% 0.20% 2.18% 40.67% NA
Japonica Intermediate  241 66.40% 0.00% 0.83% 32.78% NA
VI/Aromatic  96 82.30% 2.10% 8.33% 7.29% NA
Intermediate  90 83.30% 2.20% 3.33% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005529461 C -> T LOC_Os10g10110-LOC_Os10g10130 intergenic_region ; MODIFIER silent_mutation Average:43.107; most accessible tissue: Zhenshan97 flag leaf, score: 86.78 N N N N
vg1005529461 C -> DEL N N silent_mutation Average:43.107; most accessible tissue: Zhenshan97 flag leaf, score: 86.78 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1005529461 C T 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005529461 NA 4.00E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 4.63E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 7.09E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 9.47E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 3.32E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 6.11E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 1.37E-13 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 2.02E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 2.71E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 1.62E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 1.30E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 1.40E-12 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 1.02E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 1.10E-43 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 1.73E-54 mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 2.42E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 6.18E-14 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 1.61E-06 NA mr1705 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 6.51E-46 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 2.06E-08 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 4.21E-07 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 5.42E-20 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 3.54E-12 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 2.86E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 1.41E-07 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 4.82E-36 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 2.33E-53 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005529461 NA 6.62E-30 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251