\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005491113:

Variant ID: vg1005491113 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 5491113
Reference Allele: TAlternative Allele: C,G,TG,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTCCAAGTCATCCGCAAAAGCAAATATTAGTACTGCAGGAGGCAGTGAGGCACCCCACGAAGTAGGTGAAGCAACTGTACGGCTTCCTCGTTTCAAAT[T/C,G,TG,A]
CTGTTTAGATGGGACTAAAACTTTTAAAACTTTTAAGTTCCTATCACATCGGATGTTTGAAAATTAATTATAAATATTAAACGTAGACTATTAATAAAAC

Reverse complement sequence

GTTTTATTAATAGTCTACGTTTAATATTTATAATTAATTTTCAAACATCCGATGTGATAGGAACTTAAAAGTTTTAAAAGTTTTAGTCCCATCTAAACAG[A/G,C,CA,T]
ATTTGAAACGAGGAAGCCGTACAGTTGCTTCACCTACTTCGTGGGGTGCCTCACTGCCTCCTGCAGTACTAATATTTGCTTTTGCGGATGACTTGGACAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.30% 22.80% 5.82% 20.76% TG: 2.20%; A: 0.59%; G: 0.53%
All Indica  2759 75.50% 1.80% 2.14% 17.87% TG: 1.81%; A: 0.47%; G: 0.40%
All Japonica  1512 4.00% 64.20% 10.85% 17.20% TG: 2.45%; G: 0.86%; A: 0.46%
Aus  269 1.90% 0.70% 15.99% 73.98% TG: 4.46%; A: 2.60%; G: 0.37%
Indica I  595 97.50% 0.70% 0.17% 1.51% TG: 0.17%
Indica II  465 78.30% 1.70% 2.15% 16.13% TG: 1.08%; G: 0.43%; A: 0.22%
Indica III  913 61.20% 2.60% 2.52% 28.70% TG: 3.50%; A: 0.77%; G: 0.66%
Indica Intermediate  786 73.70% 1.90% 3.18% 18.70% TG: 1.53%; A: 0.64%; G: 0.38%
Temperate Japonica  767 2.60% 79.30% 9.65% 6.78% TG: 0.91%; G: 0.39%; A: 0.39%
Tropical Japonica  504 1.80% 49.00% 11.71% 32.34% TG: 3.17%; G: 1.19%; A: 0.79%
Japonica Intermediate  241 13.30% 47.70% 12.86% 18.67% TG: 5.81%; G: 1.66%
VI/Aromatic  96 50.00% 29.20% 4.17% 13.54% TG: 2.08%; A: 1.04%
Intermediate  90 43.30% 30.00% 5.56% 17.78% TG: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005491113 T -> C LOC_Os10g10080.1 upstream_gene_variant ; 662.0bp to feature; MODIFIER silent_mutation Average:92.171; most accessible tissue: Minghui63 root, score: 98.416 N N N N
vg1005491113 T -> C LOC_Os10g10080.2 upstream_gene_variant ; 864.0bp to feature; MODIFIER silent_mutation Average:92.171; most accessible tissue: Minghui63 root, score: 98.416 N N N N
vg1005491113 T -> C LOC_Os10g10080.3 upstream_gene_variant ; 657.0bp to feature; MODIFIER silent_mutation Average:92.171; most accessible tissue: Minghui63 root, score: 98.416 N N N N
vg1005491113 T -> C LOC_Os10g10080-LOC_Os10g10090 intergenic_region ; MODIFIER silent_mutation Average:92.171; most accessible tissue: Minghui63 root, score: 98.416 N N N N
vg1005491113 T -> TG LOC_Os10g10080.1 upstream_gene_variant ; 663.0bp to feature; MODIFIER silent_mutation Average:92.171; most accessible tissue: Minghui63 root, score: 98.416 N N N N
vg1005491113 T -> TG LOC_Os10g10080.2 upstream_gene_variant ; 865.0bp to feature; MODIFIER silent_mutation Average:92.171; most accessible tissue: Minghui63 root, score: 98.416 N N N N
vg1005491113 T -> TG LOC_Os10g10080.3 upstream_gene_variant ; 658.0bp to feature; MODIFIER silent_mutation Average:92.171; most accessible tissue: Minghui63 root, score: 98.416 N N N N
vg1005491113 T -> TG LOC_Os10g10080-LOC_Os10g10090 intergenic_region ; MODIFIER silent_mutation Average:92.171; most accessible tissue: Minghui63 root, score: 98.416 N N N N
vg1005491113 T -> G LOC_Os10g10080.1 upstream_gene_variant ; 662.0bp to feature; MODIFIER silent_mutation Average:92.171; most accessible tissue: Minghui63 root, score: 98.416 N N N N
vg1005491113 T -> G LOC_Os10g10080.2 upstream_gene_variant ; 864.0bp to feature; MODIFIER silent_mutation Average:92.171; most accessible tissue: Minghui63 root, score: 98.416 N N N N
vg1005491113 T -> G LOC_Os10g10080.3 upstream_gene_variant ; 657.0bp to feature; MODIFIER silent_mutation Average:92.171; most accessible tissue: Minghui63 root, score: 98.416 N N N N
vg1005491113 T -> G LOC_Os10g10080-LOC_Os10g10090 intergenic_region ; MODIFIER silent_mutation Average:92.171; most accessible tissue: Minghui63 root, score: 98.416 N N N N
vg1005491113 T -> DEL N N silent_mutation Average:92.171; most accessible tissue: Minghui63 root, score: 98.416 N N N N
vg1005491113 T -> A LOC_Os10g10080.1 upstream_gene_variant ; 662.0bp to feature; MODIFIER silent_mutation Average:92.171; most accessible tissue: Minghui63 root, score: 98.416 N N N N
vg1005491113 T -> A LOC_Os10g10080.2 upstream_gene_variant ; 864.0bp to feature; MODIFIER silent_mutation Average:92.171; most accessible tissue: Minghui63 root, score: 98.416 N N N N
vg1005491113 T -> A LOC_Os10g10080.3 upstream_gene_variant ; 657.0bp to feature; MODIFIER silent_mutation Average:92.171; most accessible tissue: Minghui63 root, score: 98.416 N N N N
vg1005491113 T -> A LOC_Os10g10080-LOC_Os10g10090 intergenic_region ; MODIFIER silent_mutation Average:92.171; most accessible tissue: Minghui63 root, score: 98.416 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1005491113 T A 0.11 0.03 0.02 0.01 0.03 0.04
vg1005491113 T C 0.05 0.02 0.02 0.01 0.01 -0.01
vg1005491113 T G 0.04 0.0 -0.04 -0.01 -0.02 -0.04
vg1005491113 T TG 0.1 0.09 0.0 0.0 0.1 0.18

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005491113 NA 3.95E-12 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005491113 NA 4.10E-07 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005491113 NA 1.16E-06 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005491113 7.15E-08 5.53E-20 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005491113 1.65E-06 3.30E-13 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005491113 NA 7.86E-11 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005491113 3.04E-08 8.46E-28 mr1495 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005491113 1.26E-07 1.56E-17 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005491113 NA 4.44E-06 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005491113 NA 8.13E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005491113 NA 6.49E-07 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005491113 NA 1.25E-07 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005491113 3.50E-07 4.94E-22 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005491113 1.83E-08 7.13E-16 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005491113 NA 4.91E-08 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005491113 NA 8.14E-13 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005491113 NA 6.21E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005491113 NA 2.17E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005491113 1.02E-07 1.52E-30 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005491113 1.47E-07 1.15E-16 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005491113 NA 6.14E-06 mr1913_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005491113 NA 5.05E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251