Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005490148:

Variant ID: vg1005490148 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5490148
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATCAAATTCCGGCCACCAAAAACGCGACGAGGGGCATAGCACGCGTGTGATTCCTCAGATCTATGCAACAACCGACGGCGCGTAATTAATTGGATTACC[G/T]
GAGCAACAGACGCACATACCTTTGATCCGCTCGATGCCCTGAGCGGCCGCGGCTGCGACGCCGGAAGAACAGGCGAAGAGAAGAAGCACGGCGAGCGGCA

Reverse complement sequence

TGCCGCTCGCCGTGCTTCTTCTCTTCGCCTGTTCTTCCGGCGTCGCAGCCGCGGCCGCTCAGGGCATCGAGCGGATCAAAGGTATGTGCGTCTGTTGCTC[C/A]
GGTAATCCAATTAATTACGCGCCGTCGGTTGTTGCATAGATCTGAGGAATCACACGCGTGCTATGCCCCTCGTCGCGTTTTTGGTGGCCGGAATTTGATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 4.00% 2.69% 0.00% NA
All Indica  2759 89.50% 6.90% 3.62% 0.00% NA
All Japonica  1512 98.40% 0.10% 1.52% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 62.00% 25.50% 12.44% 0.00% NA
Indica II  465 98.50% 0.20% 1.29% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 93.00% 4.60% 2.42% 0.00% NA
Temperate Japonica  767 97.30% 0.10% 2.61% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.40% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 1.10% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005490148 G -> T LOC_Os10g10080.1 intron_variant ; MODIFIER silent_mutation Average:90.897; most accessible tissue: Minghui63 root, score: 97.979 N N N N
vg1005490148 G -> T LOC_Os10g10080.2 intron_variant ; MODIFIER silent_mutation Average:90.897; most accessible tissue: Minghui63 root, score: 97.979 N N N N
vg1005490148 G -> T LOC_Os10g10080.3 intron_variant ; MODIFIER silent_mutation Average:90.897; most accessible tissue: Minghui63 root, score: 97.979 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1005490148 G T 0.0 0.01 0.01 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005490148 7.09E-06 4.24E-08 mr1002 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005490148 NA 1.94E-11 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005490148 NA 7.57E-06 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005490148 NA 4.07E-10 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005490148 NA 7.93E-06 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005490148 NA 3.77E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005490148 NA 1.63E-11 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005490148 NA 3.35E-08 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005490148 NA 3.47E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251