\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005485300:

Variant ID: vg1005485300 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5485300
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGAGAGTGTGCATCTCCTTATATAGGTAGGTATGACGGTTGTAGAGTATGGGAATTGTCGGAAATGCCCCGCAACCACCATCAGGAGTTCATCCGGAGC[A/G]
TCCACGCCAAACCCCAGCCTGAACGGCTGTGATGGAAGTTCAGCCGAACCATGATCTGGCCCAAACGGCCCAATTTTTGGCAAGGCGACTCCTCGTTTGC

Reverse complement sequence

GCAAACGAGGAGTCGCCTTGCCAAAAATTGGGCCGTTTGGGCCAGATCATGGTTCGGCTGAACTTCCATCACAGCCGTTCAGGCTGGGGTTTGGCGTGGA[T/C]
GCTCCGGATGAACTCCTGATGGTGGTTGCGGGGCATTTCCGACAATTCCCATACTCTACAACCGTCATACCTACCTATATAAGGAGATGCACACTCTCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.10% 2.20% 0.78% 23.89% NA
All Indica  2759 81.50% 0.50% 0.36% 17.65% NA
All Japonica  1512 63.70% 5.40% 1.52% 29.43% NA
Aus  269 49.80% 0.00% 0.37% 49.81% NA
Indica I  595 92.10% 0.00% 0.00% 7.90% NA
Indica II  465 89.50% 0.00% 1.08% 9.46% NA
Indica III  913 71.30% 1.40% 0.55% 26.73% NA
Indica Intermediate  786 80.70% 0.00% 0.00% 19.34% NA
Temperate Japonica  767 70.80% 10.60% 1.43% 17.21% NA
Tropical Japonica  504 55.60% 0.00% 1.59% 42.86% NA
Japonica Intermediate  241 58.10% 0.00% 1.66% 40.25% NA
VI/Aromatic  96 44.80% 9.40% 3.12% 42.71% NA
Intermediate  90 75.60% 0.00% 0.00% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005485300 A -> G LOC_Os10g10080.1 downstream_gene_variant ; 1708.0bp to feature; MODIFIER silent_mutation Average:40.225; most accessible tissue: Zhenshan97 root, score: 74.04 N N N N
vg1005485300 A -> G LOC_Os10g10080.2 downstream_gene_variant ; 1708.0bp to feature; MODIFIER silent_mutation Average:40.225; most accessible tissue: Zhenshan97 root, score: 74.04 N N N N
vg1005485300 A -> G LOC_Os10g10080.3 downstream_gene_variant ; 1708.0bp to feature; MODIFIER silent_mutation Average:40.225; most accessible tissue: Zhenshan97 root, score: 74.04 N N N N
vg1005485300 A -> G LOC_Os10g10060-LOC_Os10g10080 intergenic_region ; MODIFIER silent_mutation Average:40.225; most accessible tissue: Zhenshan97 root, score: 74.04 N N N N
vg1005485300 A -> DEL N N silent_mutation Average:40.225; most accessible tissue: Zhenshan97 root, score: 74.04 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005485300 NA 4.00E-10 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005485300 NA 8.15E-06 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005485300 1.50E-06 NA mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005485300 2.04E-06 1.97E-12 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005485300 8.80E-06 NA mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005485300 9.83E-07 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005485300 4.28E-07 1.86E-16 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005485300 NA 9.63E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005485300 4.45E-06 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005485300 1.10E-08 1.07E-15 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005485300 NA 1.79E-10 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005485300 5.06E-07 NA mr1495_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005485300 1.81E-07 7.08E-17 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005485300 NA 7.88E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251