\
| Variant ID: vg1005485300 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5485300 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAGAGAGTGTGCATCTCCTTATATAGGTAGGTATGACGGTTGTAGAGTATGGGAATTGTCGGAAATGCCCCGCAACCACCATCAGGAGTTCATCCGGAGC[A/G]
TCCACGCCAAACCCCAGCCTGAACGGCTGTGATGGAAGTTCAGCCGAACCATGATCTGGCCCAAACGGCCCAATTTTTGGCAAGGCGACTCCTCGTTTGC
GCAAACGAGGAGTCGCCTTGCCAAAAATTGGGCCGTTTGGGCCAGATCATGGTTCGGCTGAACTTCCATCACAGCCGTTCAGGCTGGGGTTTGGCGTGGA[T/C]
GCTCCGGATGAACTCCTGATGGTGGTTGCGGGGCATTTCCGACAATTCCCATACTCTACAACCGTCATACCTACCTATATAAGGAGATGCACACTCTCTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.10% | 2.20% | 0.78% | 23.89% | NA |
| All Indica | 2759 | 81.50% | 0.50% | 0.36% | 17.65% | NA |
| All Japonica | 1512 | 63.70% | 5.40% | 1.52% | 29.43% | NA |
| Aus | 269 | 49.80% | 0.00% | 0.37% | 49.81% | NA |
| Indica I | 595 | 92.10% | 0.00% | 0.00% | 7.90% | NA |
| Indica II | 465 | 89.50% | 0.00% | 1.08% | 9.46% | NA |
| Indica III | 913 | 71.30% | 1.40% | 0.55% | 26.73% | NA |
| Indica Intermediate | 786 | 80.70% | 0.00% | 0.00% | 19.34% | NA |
| Temperate Japonica | 767 | 70.80% | 10.60% | 1.43% | 17.21% | NA |
| Tropical Japonica | 504 | 55.60% | 0.00% | 1.59% | 42.86% | NA |
| Japonica Intermediate | 241 | 58.10% | 0.00% | 1.66% | 40.25% | NA |
| VI/Aromatic | 96 | 44.80% | 9.40% | 3.12% | 42.71% | NA |
| Intermediate | 90 | 75.60% | 0.00% | 0.00% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005485300 | A -> G | LOC_Os10g10080.1 | downstream_gene_variant ; 1708.0bp to feature; MODIFIER | silent_mutation | Average:40.225; most accessible tissue: Zhenshan97 root, score: 74.04 | N | N | N | N |
| vg1005485300 | A -> G | LOC_Os10g10080.2 | downstream_gene_variant ; 1708.0bp to feature; MODIFIER | silent_mutation | Average:40.225; most accessible tissue: Zhenshan97 root, score: 74.04 | N | N | N | N |
| vg1005485300 | A -> G | LOC_Os10g10080.3 | downstream_gene_variant ; 1708.0bp to feature; MODIFIER | silent_mutation | Average:40.225; most accessible tissue: Zhenshan97 root, score: 74.04 | N | N | N | N |
| vg1005485300 | A -> G | LOC_Os10g10060-LOC_Os10g10080 | intergenic_region ; MODIFIER | silent_mutation | Average:40.225; most accessible tissue: Zhenshan97 root, score: 74.04 | N | N | N | N |
| vg1005485300 | A -> DEL | N | N | silent_mutation | Average:40.225; most accessible tissue: Zhenshan97 root, score: 74.04 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005485300 | NA | 4.00E-10 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005485300 | NA | 8.15E-06 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005485300 | 1.50E-06 | NA | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005485300 | 2.04E-06 | 1.97E-12 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005485300 | 8.80E-06 | NA | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005485300 | 9.83E-07 | NA | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005485300 | 4.28E-07 | 1.86E-16 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005485300 | NA | 9.63E-06 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005485300 | 4.45E-06 | NA | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005485300 | 1.10E-08 | 1.07E-15 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005485300 | NA | 1.79E-10 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005485300 | 5.06E-07 | NA | mr1495_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005485300 | 1.81E-07 | 7.08E-17 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005485300 | NA | 7.88E-06 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |