Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005442099:

Variant ID: vg1005442099 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5442099
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

ACCGGCTGGGCCATGTGATCTGGAAGCAGCTGGAGCAATATCAGTAGATTGGTTTTGTAAAAAATAATATAACAAGACTAGCACCAGCATGTTTTCCACA[G/A]
AGCTGAAGCACCGCCACTTCACCGTCTAAAAATATAACTAACTTAATCCTCTAAATTAATATTATGCAATAAACATTCTTGAGTCCATACATTAAGATGT

Reverse complement sequence

ACATCTTAATGTATGGACTCAAGAATGTTTATTGCATAATATTAATTTAGAGGATTAAGTTAGTTATATTTTTAGACGGTGAAGTGGCGGTGCTTCAGCT[C/T]
TGTGGAAAACATGCTGGTGCTAGTCTTGTTATATTATTTTTTACAAAACCAATCTACTGATATTGCTCCAGCTGCTTCCAGATCACATGGCCCAGCCGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.80%	34.80%	0.02%	0.30%	NA
All Indica	2759	43.90%	55.60%	0.00%	0.43%	NA
All Japonica	1512	95.00%	4.80%	0.07%	0.07%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	11.30%	88.70%	0.00%	0.00%	NA
Indica II	465	40.20%	58.90%	0.00%	0.86%	NA
Indica III	913	65.70%	33.80%	0.00%	0.44%	NA
Indica Intermediate	786	45.50%	53.90%	0.00%	0.51%	NA
Temperate Japonica	767	92.60%	7.30%	0.13%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	95.90%	3.70%	0.00%	0.41%	NA
VI/Aromatic	96	84.40%	15.60%	0.00%	0.00%	NA
Intermediate	90	73.30%	25.60%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005442099	G -> A	LOC_Os10g10020.1	downstream_gene_variant ; 4312.0bp to feature; MODIFIER	silent_mutation	Average:44.062; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg1005442099	G -> A	LOC_Os10g10030.1	downstream_gene_variant ; 45.0bp to feature; MODIFIER	silent_mutation	Average:44.062; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg1005442099	G -> A	LOC_Os10g10020-LOC_Os10g10030	intergenic_region ; MODIFIER	silent_mutation	Average:44.062; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg1005442099	G -> DEL	N	N	silent_mutation	Average:44.062; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005442099	NA	1.58E-32	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005442099	NA	4.95E-06	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005442099	NA	5.89E-09	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005442099	1.04E-06	1.35E-08	mr1120	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005442099	NA	3.33E-07	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005442099	NA	2.08E-14	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005442099	NA	3.09E-11	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005442099	NA	5.16E-07	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005442099	NA	2.81E-07	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005442099	NA	7.51E-06	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005442099	NA	1.15E-06	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005442099	NA	2.27E-09	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005442099	NA	2.05E-33	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005442099	NA	2.02E-10	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005442099	NA	1.25E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005442099	NA	2.37E-08	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005442099	NA	3.29E-06	mr1879_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005442099	NA	9.68E-07	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251