\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005441451:

Variant ID: vg1005441451 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5441451
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, T: 0.08, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTCATTGTATGAGACACAAAAGCTGGTTCACTTTTGTAAGTAAAGTAAACCAGTTAGCCACAAAGAAATTCTTCAGTGTCACAAAGTATTCAATGGTA[G/T]
CTACAATAATTGTGCTACCAAAACCCAAAATGGTAGATTTATCATCTTTCCTATGCTTTTTTGGCTTTTGAGGTGGTGACATTTCTACTGAAGCTGCACT

Reverse complement sequence

AGTGCAGCTTCAGTAGAAATGTCACCACCTCAAAAGCCAAAAAAGCATAGGAAAGATGATAAATCTACCATTTTGGGTTTTGGTAGCACAATTATTGTAG[C/A]
TACCATTGAATACTTTGTGACACTGAAGAATTTCTTTGTGGCTAACTGGTTTACTTTACTTACAAAAGTGAACCAGCTTTTGTGTCTCATACAATGAAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.00% 42.70% 0.00% 0.32% NA
All Indica  2759 39.80% 59.80% 0.00% 0.43% NA
All Japonica  1512 97.50% 2.40% 0.00% 0.07% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 9.40% 90.60% 0.00% 0.00% NA
Indica II  465 36.10% 63.00% 0.00% 0.86% NA
Indica III  913 62.00% 37.60% 0.00% 0.44% NA
Indica Intermediate  786 39.20% 60.30% 0.00% 0.51% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 97.60% 2.40% 0.00% 0.00% NA
Japonica Intermediate  241 93.80% 5.80% 0.00% 0.41% NA
VI/Aromatic  96 61.50% 38.50% 0.00% 0.00% NA
Intermediate  90 64.40% 33.30% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005441451 G -> T LOC_Os10g10020.1 downstream_gene_variant ; 3664.0bp to feature; MODIFIER silent_mutation Average:57.172; most accessible tissue: Callus, score: 79.953 N N N N
vg1005441451 G -> T LOC_Os10g10030.1 downstream_gene_variant ; 693.0bp to feature; MODIFIER silent_mutation Average:57.172; most accessible tissue: Callus, score: 79.953 N N N N
vg1005441451 G -> T LOC_Os10g10020-LOC_Os10g10030 intergenic_region ; MODIFIER silent_mutation Average:57.172; most accessible tissue: Callus, score: 79.953 N N N N
vg1005441451 G -> DEL N N silent_mutation Average:57.172; most accessible tissue: Callus, score: 79.953 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005441451 NA 4.24E-08 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 9.95E-06 1.55E-10 mr1114 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 7.91E-06 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 8.96E-16 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 5.17E-06 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 2.58E-07 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 7.61E-07 7.30E-10 mr1247 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 4.52E-26 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 1.90E-07 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 2.31E-09 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 9.70E-10 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 1.23E-07 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 3.26E-08 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 9.58E-06 1.02E-11 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 1.06E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 4.13E-11 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 1.76E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 3.13E-25 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 4.12E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 5.16E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 4.33E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 4.78E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 4.31E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 1.70E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 4.55E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 2.12E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 2.11E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 3.95E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 1.51E-17 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005441451 NA 4.70E-06 mr1879_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251