Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1005435328:

Variant ID: vg1005435328 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5435328
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATCAATAACTTAGACGTTGGTCTAGGTTAGTGGTTACCTTCGTTTGTTGTGTGCTTCCTGGAAGTGAGGGAGGCAGCAGGTGGTGATAGCCATGTCCAT[T/C]
CTTTGTATCCCTAAACGGTCGGTATGTCATAGAGTTATAGTGTTTTACCTTTAACTTAAGTATTGTTAATTAAAGGAACAAGTACGAAGTACCCCCTGAA

Reverse complement sequence

TTCAGGGGGTACTTCGTACTTGTTCCTTTAATTAACAATACTTAAGTTAAAGGTAAAACACTATAACTCTATGACATACCGACCGTTTAGGGATACAAAG[A/G]
ATGGACATGGCTATCACCACCTGCTGCCTCCCTCACTTCCAGGAAGCACACAACAAACGAAGGTAACCACTAACCTAGACCAACGTCTAAGTTATTGATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 10.20% 0.00% 0.00% NA
All Indica  2759 97.10% 2.90% 0.00% 0.00% NA
All Japonica  1512 95.30% 4.70% 0.00% 0.00% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 97.70% 2.30% 0.00% 0.00% NA
Indica Intermediate  786 94.40% 5.60% 0.00% 0.00% NA
Temperate Japonica  767 93.50% 6.50% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 50.00% 50.00% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005435328 T -> C LOC_Os10g10020.1 upstream_gene_variant ; 477.0bp to feature; MODIFIER silent_mutation Average:46.999; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg1005435328 T -> C LOC_Os10g10010-LOC_Os10g10020 intergenic_region ; MODIFIER silent_mutation Average:46.999; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005435328 NA 7.95E-09 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005435328 NA 3.35E-16 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005435328 2.67E-07 8.60E-34 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005435328 1.85E-08 1.21E-40 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005435328 6.07E-07 5.90E-20 mr1409 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005435328 NA 3.08E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005435328 5.09E-07 1.62E-39 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005435328 NA 2.59E-15 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005435328 NA 1.26E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005435328 NA 2.91E-22 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005435328 NA 2.82E-13 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005435328 NA 2.43E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005435328 NA 3.42E-28 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005435328 NA 2.09E-16 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005435328 NA 6.71E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005435328 NA 2.31E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005435328 NA 2.00E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251