\
| Variant ID: vg1005434563 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5434563 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.22, others allele: 0.00, population size: 191. )
TCCATGAGCTTCACTCAGCGAGTGTAAAGGATAATTGTGGGGGTATTGTTAATGGTTGTTAAATTTAATATTAAACTCAATGGTAGGGGTTTATTACTAA[T/C]
TGTTTCCACTTGTATTGGTAAATATATGCATGTAGGTGATTTTCAAAGAATTTACATCCTCCATGCAACGAAATATACCTCCAGCCAATCATACGCGAGC
GCTCGCGTATGATTGGCTGGAGGTATATTTCGTTGCATGGAGGATGTAAATTCTTTGAAAATCACCTACATGCATATATTTACCAATACAAGTGGAAACA[A/G]
TTAGTAATAAACCCCTACCATTGAGTTTAATATTAAATTTAACAACCATTAACAATACCCCCACAATTATCCTTTACACTCGCTGAGTGAAGCTCATGGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.70% | 12.30% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.10% | 98.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 85.00% | 15.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 43.80% | 56.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005434563 | T -> C | LOC_Os10g10010.1 | upstream_gene_variant ; 4907.0bp to feature; MODIFIER | silent_mutation | Average:49.246; most accessible tissue: Minghui63 young leaf, score: 72.408 | N | N | N | N |
| vg1005434563 | T -> C | LOC_Os10g10020.1 | upstream_gene_variant ; 1242.0bp to feature; MODIFIER | silent_mutation | Average:49.246; most accessible tissue: Minghui63 young leaf, score: 72.408 | N | N | N | N |
| vg1005434563 | T -> C | LOC_Os10g10010-LOC_Os10g10020 | intergenic_region ; MODIFIER | silent_mutation | Average:49.246; most accessible tissue: Minghui63 young leaf, score: 72.408 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005434563 | NA | 5.09E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005434563 | NA | 4.99E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005434563 | NA | 8.43E-07 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005434563 | NA | 1.11E-27 | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005434563 | NA | 1.42E-31 | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005434563 | NA | 7.95E-07 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005434563 | NA | 9.00E-10 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005434563 | NA | 6.71E-15 | mr1409 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005434563 | NA | 1.13E-08 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005434563 | NA | 5.63E-31 | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005434563 | NA | 4.22E-14 | mr1649 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005434563 | NA | 5.14E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005434563 | NA | 6.00E-07 | mr1738 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005434563 | NA | 5.26E-18 | mr1765 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005434563 | NA | 6.29E-10 | mr1927 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005434563 | NA | 4.77E-23 | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005434563 | NA | 2.67E-06 | mr1360_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005434563 | NA | 1.04E-14 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005434563 | NA | 2.13E-10 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005434563 | 7.64E-11 | NA | mr1768_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005434563 | 2.31E-06 | 1.72E-06 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |