\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005431953:

Variant ID: vg1005431953 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5431953
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTGACGTAAGAGAGAGCTATTGCTTGAGGTGTGTGTGAAGTGAAGAGAGTGAGCTCCTTATATAAAGGTAGTTATGACGGTTGTGGAAGGGGAATT[C/G]
TCCGGAGTGCCCTCCAATCGTTATTGGGATGCAATCCTGGACGTCCACTCCAAAACCTAGATCCAACGGCGCCAAGATTGGTTCGGCCTCGGCCGATCCT

Reverse complement sequence

AGGATCGGCCGAGGCCGAACCAATCTTGGCGCCGTTGGATCTAGGTTTTGGAGTGGACGTCCAGGATTGCATCCCAATAACGATTGGAGGGCACTCCGGA[G/C]
AATTCCCCTTCCACAACCGTCATAACTACCTTTATATAAGGAGCTCACTCTCTTCACTTCACACACACCTCAAGCAATAGCTCTCTCTTACGTCAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.90% 3.30% 8.00% 1.76% NA
All Indica  2759 96.50% 0.70% 2.43% 0.40% NA
All Japonica  1512 87.20% 8.50% 4.03% 0.26% NA
Aus  269 3.00% 0.00% 73.23% 23.79% NA
Indica I  595 98.50% 0.00% 0.67% 0.84% NA
Indica II  465 98.70% 0.00% 1.08% 0.22% NA
Indica III  913 95.90% 1.60% 2.30% 0.11% NA
Indica Intermediate  786 94.40% 0.40% 4.71% 0.51% NA
Temperate Japonica  767 79.30% 14.70% 6.00% 0.00% NA
Tropical Japonica  504 97.80% 0.40% 1.19% 0.60% NA
Japonica Intermediate  241 90.00% 5.80% 3.73% 0.41% NA
VI/Aromatic  96 46.90% 8.30% 40.62% 4.17% NA
Intermediate  90 82.20% 2.20% 15.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005431953 C -> G LOC_Os10g10010.1 upstream_gene_variant ; 2297.0bp to feature; MODIFIER silent_mutation Average:46.663; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg1005431953 C -> G LOC_Os10g10020.1 upstream_gene_variant ; 3852.0bp to feature; MODIFIER silent_mutation Average:46.663; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg1005431953 C -> G LOC_Os10g10000.1 downstream_gene_variant ; 4206.0bp to feature; MODIFIER silent_mutation Average:46.663; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg1005431953 C -> G LOC_Os10g10010-LOC_Os10g10020 intergenic_region ; MODIFIER silent_mutation Average:46.663; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg1005431953 C -> DEL N N silent_mutation Average:46.663; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005431953 NA 1.09E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 5.31E-09 2.99E-31 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 NA 1.94E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 NA 2.11E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 4.24E-09 6.47E-36 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 NA 2.01E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 NA 1.21E-06 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 NA 5.02E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 NA 2.73E-19 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 NA 8.22E-12 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 NA 1.42E-09 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 1.63E-07 6.05E-36 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 NA 3.59E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 NA 1.00E-16 mr1649 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 NA 4.63E-06 mr1738 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 NA 2.60E-19 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 9.11E-08 8.75E-26 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 NA 1.64E-07 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 NA 2.28E-18 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 NA 2.01E-10 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 NA 3.32E-10 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 NA 2.37E-11 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 NA 1.36E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953 6.52E-07 NA mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251