Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005431953:

Variant ID: vg1005431953 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5431953
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTTTGACGTAAGAGAGAGCTATTGCTTGAGGTGTGTGTGAAGTGAAGAGAGTGAGCTCCTTATATAAAGGTAGTTATGACGGTTGTGGAAGGGGAATT[C/G]
TCCGGAGTGCCCTCCAATCGTTATTGGGATGCAATCCTGGACGTCCACTCCAAAACCTAGATCCAACGGCGCCAAGATTGGTTCGGCCTCGGCCGATCCT

Reverse complement sequence

AGGATCGGCCGAGGCCGAACCAATCTTGGCGCCGTTGGATCTAGGTTTTGGAGTGGACGTCCAGGATTGCATCCCAATAACGATTGGAGGGCACTCCGGA[G/C]
AATTCCCCTTCCACAACCGTCATAACTACCTTTATATAAGGAGCTCACTCTCTTCACTTCACACACACCTCAAGCAATAGCTCTCTCTTACGTCAAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.90%	3.30%	8.00%	1.76%	NA
All Indica	2759	96.50%	0.70%	2.43%	0.40%	NA
All Japonica	1512	87.20%	8.50%	4.03%	0.26%	NA
Aus	269	3.00%	0.00%	73.23%	23.79%	NA
Indica I	595	98.50%	0.00%	0.67%	0.84%	NA
Indica II	465	98.70%	0.00%	1.08%	0.22%	NA
Indica III	913	95.90%	1.60%	2.30%	0.11%	NA
Indica Intermediate	786	94.40%	0.40%	4.71%	0.51%	NA
Temperate Japonica	767	79.30%	14.70%	6.00%	0.00%	NA
Tropical Japonica	504	97.80%	0.40%	1.19%	0.60%	NA
Japonica Intermediate	241	90.00%	5.80%	3.73%	0.41%	NA
VI/Aromatic	96	46.90%	8.30%	40.62%	4.17%	NA
Intermediate	90	82.20%	2.20%	15.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005431953	C -> G	LOC_Os10g10010.1	upstream_gene_variant ; 2297.0bp to feature; MODIFIER	silent_mutation	Average:46.663; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg1005431953	C -> G	LOC_Os10g10020.1	upstream_gene_variant ; 3852.0bp to feature; MODIFIER	silent_mutation	Average:46.663; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg1005431953	C -> G	LOC_Os10g10000.1	downstream_gene_variant ; 4206.0bp to feature; MODIFIER	silent_mutation	Average:46.663; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg1005431953	C -> G	LOC_Os10g10010-LOC_Os10g10020	intergenic_region ; MODIFIER	silent_mutation	Average:46.663; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg1005431953	C -> DEL	N	N	silent_mutation	Average:46.663; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005431953	NA	1.09E-06	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	5.31E-09	2.99E-31	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	NA	1.94E-07	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	NA	2.11E-06	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	4.24E-09	6.47E-36	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	NA	2.01E-07	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	NA	1.21E-06	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	NA	5.02E-09	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	NA	2.73E-19	mr1409	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	NA	8.22E-12	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	NA	1.42E-09	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	1.63E-07	6.05E-36	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	NA	3.59E-06	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	NA	1.00E-16	mr1649	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	NA	4.63E-06	mr1738	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	NA	2.60E-19	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	9.11E-08	8.75E-26	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	NA	1.64E-07	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	NA	2.28E-18	mr1409_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	NA	2.01E-10	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	NA	3.32E-10	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	NA	2.37E-11	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	NA	1.36E-08	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431953	6.52E-07	NA	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251