\
| Variant ID: vg1005431305 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5431305 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, others allele: 0.00, population size: 111. )
TTCTAATATACATAGTATACATACATCCTATTTAACTGATATACTAGCTAATACCCTCTTTCCGATGCCCTCCTAGTAAGTCGAGAAACCACCCCTGACT[G/A]
CCGAGTTCCTTACGACAGCCCGTCATGACCATACAACCGGGGCTAAATACGGAGGAATACCCTCCCCAGGGAATTAACTTAGGATTATATATAGGCCCGG
CCGGGCCTATATATAATCCTAAGTTAATTCCCTGGGGAGGGTATTCCTCCGTATTTAGCCCCGGTTGTATGGTCATGACGGGCTGTCGTAAGGAACTCGG[C/T]
AGTCAGGGGTGGTTTCTCGACTTACTAGGAGGGCATCGGAAAGAGGGTATTAGCTAGTATATCAGTTAAATAGGATGTATGTATACTATGTATATTAGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.90% | 42.00% | 2.86% | 0.30% | NA |
| All Indica | 2759 | 28.50% | 69.30% | 1.96% | 0.22% | NA |
| All Japonica | 1512 | 97.50% | 1.50% | 0.93% | 0.07% | NA |
| Aus | 269 | 74.30% | 1.50% | 21.93% | 2.23% | NA |
| Indica I | 595 | 7.90% | 90.80% | 1.34% | 0.00% | NA |
| Indica II | 465 | 19.10% | 78.30% | 2.15% | 0.43% | NA |
| Indica III | 913 | 47.80% | 50.30% | 1.64% | 0.33% | NA |
| Indica Intermediate | 786 | 27.40% | 69.80% | 2.67% | 0.13% | NA |
| Temperate Japonica | 767 | 98.30% | 1.00% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 1.20% | 0.60% | 0.20% | NA |
| Japonica Intermediate | 241 | 93.80% | 3.70% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 76.00% | 18.80% | 5.21% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 30.00% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005431305 | G -> A | LOC_Os10g10010.1 | upstream_gene_variant ; 1649.0bp to feature; MODIFIER | silent_mutation | Average:42.732; most accessible tissue: Zhenshan97 root, score: 54.262 | N | N | N | N |
| vg1005431305 | G -> A | LOC_Os10g10020.1 | upstream_gene_variant ; 4500.0bp to feature; MODIFIER | silent_mutation | Average:42.732; most accessible tissue: Zhenshan97 root, score: 54.262 | N | N | N | N |
| vg1005431305 | G -> A | LOC_Os10g10000.1 | downstream_gene_variant ; 3558.0bp to feature; MODIFIER | silent_mutation | Average:42.732; most accessible tissue: Zhenshan97 root, score: 54.262 | N | N | N | N |
| vg1005431305 | G -> A | LOC_Os10g10010-LOC_Os10g10020 | intergenic_region ; MODIFIER | silent_mutation | Average:42.732; most accessible tissue: Zhenshan97 root, score: 54.262 | N | N | N | N |
| vg1005431305 | G -> DEL | N | N | silent_mutation | Average:42.732; most accessible tissue: Zhenshan97 root, score: 54.262 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005431305 | NA | 3.74E-06 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005431305 | NA | 1.12E-14 | mr1199 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005431305 | NA | 1.14E-13 | mr1147_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005431305 | NA | 9.05E-08 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005431305 | NA | 3.95E-13 | mr1649_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |