\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005431305:

Variant ID: vg1005431305 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5431305
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTAATATACATAGTATACATACATCCTATTTAACTGATATACTAGCTAATACCCTCTTTCCGATGCCCTCCTAGTAAGTCGAGAAACCACCCCTGACT[G/A]
CCGAGTTCCTTACGACAGCCCGTCATGACCATACAACCGGGGCTAAATACGGAGGAATACCCTCCCCAGGGAATTAACTTAGGATTATATATAGGCCCGG

Reverse complement sequence

CCGGGCCTATATATAATCCTAAGTTAATTCCCTGGGGAGGGTATTCCTCCGTATTTAGCCCCGGTTGTATGGTCATGACGGGCTGTCGTAAGGAACTCGG[C/T]
AGTCAGGGGTGGTTTCTCGACTTACTAGGAGGGCATCGGAAAGAGGGTATTAGCTAGTATATCAGTTAAATAGGATGTATGTATACTATGTATATTAGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.90% 42.00% 2.86% 0.30% NA
All Indica  2759 28.50% 69.30% 1.96% 0.22% NA
All Japonica  1512 97.50% 1.50% 0.93% 0.07% NA
Aus  269 74.30% 1.50% 21.93% 2.23% NA
Indica I  595 7.90% 90.80% 1.34% 0.00% NA
Indica II  465 19.10% 78.30% 2.15% 0.43% NA
Indica III  913 47.80% 50.30% 1.64% 0.33% NA
Indica Intermediate  786 27.40% 69.80% 2.67% 0.13% NA
Temperate Japonica  767 98.30% 1.00% 0.65% 0.00% NA
Tropical Japonica  504 98.00% 1.20% 0.60% 0.20% NA
Japonica Intermediate  241 93.80% 3.70% 2.49% 0.00% NA
VI/Aromatic  96 76.00% 18.80% 5.21% 0.00% NA
Intermediate  90 65.60% 30.00% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005431305 G -> A LOC_Os10g10010.1 upstream_gene_variant ; 1649.0bp to feature; MODIFIER silent_mutation Average:42.732; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N
vg1005431305 G -> A LOC_Os10g10020.1 upstream_gene_variant ; 4500.0bp to feature; MODIFIER silent_mutation Average:42.732; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N
vg1005431305 G -> A LOC_Os10g10000.1 downstream_gene_variant ; 3558.0bp to feature; MODIFIER silent_mutation Average:42.732; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N
vg1005431305 G -> A LOC_Os10g10010-LOC_Os10g10020 intergenic_region ; MODIFIER silent_mutation Average:42.732; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N
vg1005431305 G -> DEL N N silent_mutation Average:42.732; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005431305 NA 3.74E-06 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431305 NA 1.12E-14 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431305 NA 1.14E-13 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431305 NA 9.05E-08 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005431305 NA 3.95E-13 mr1649_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251