\
| Variant ID: vg1005421909 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5421909 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 322. )
TTCCAAGAGCAAGCACCCGCAACCCTAAACAGTAGACCACCAAGCCCTTAGCAGACCAGCACAGCCAAGCCGCCACTAATCCTAGGAGCAACAAGTGATA[C/T]
CTACAGAAGGTATGGGTTTCAAGGGCACCGATAAAGATTCTATTGTTTCGCTAGCAACTGCTTCAAGGCTACAGAATCAGCATTAGTAGGGCAATCAATG
CATTGATTGCCCTACTAATGCTGATTCTGTAGCCTTGAAGCAGTTGCTAGCGAAACAATAGAATCTTTATCGGTGCCCTTGAAACCCATACCTTCTGTAG[G/A]
TATCACTTGTTGCTCCTAGGATTAGTGGCGGCTTGGCTGTGCTGGTCTGCTAAGGGCTTGGTGGTCTACTGTTTAGGGTTGCGGGTGCTTGCTCTTGGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.00% | 9.40% | 1.97% | 20.69% | NA |
| All Indica | 2759 | 55.30% | 13.70% | 3.19% | 27.84% | NA |
| All Japonica | 1512 | 96.20% | 0.20% | 0.20% | 3.44% | NA |
| Aus | 269 | 20.40% | 22.70% | 0.37% | 56.51% | NA |
| Indica I | 595 | 38.20% | 36.00% | 5.71% | 20.17% | NA |
| Indica II | 465 | 82.60% | 3.20% | 2.80% | 11.40% | NA |
| Indica III | 913 | 48.40% | 4.70% | 1.97% | 44.91% | NA |
| Indica Intermediate | 786 | 60.20% | 13.40% | 2.93% | 23.54% | NA |
| Temperate Japonica | 767 | 93.40% | 0.30% | 0.26% | 6.13% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.40% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 91.10% | 2.20% | 1.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005421909 | C -> T | LOC_Os10g09990-LOC_Os10g10000 | intergenic_region ; MODIFIER | silent_mutation | Average:18.412; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1005421909 | C -> DEL | N | N | silent_mutation | Average:18.412; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005421909 | NA | 5.93E-06 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005421909 | 6.06E-06 | NA | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005421909 | 1.86E-06 | 3.73E-08 | mr1547 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005421909 | NA | 7.60E-07 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005421909 | NA | 2.51E-07 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005421909 | 2.13E-07 | 3.39E-18 | mr1598 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005421909 | 3.62E-06 | 1.98E-09 | mr1598 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005421909 | 5.85E-06 | NA | mr1620 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005421909 | 2.66E-06 | NA | mr1676 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005421909 | 9.38E-06 | 7.19E-08 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005421909 | 3.61E-06 | 3.61E-06 | mr1748 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005421909 | NA | 4.66E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |