Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005384319:

Variant ID: vg1005384319 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5384319
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCGGTTGTCGACATGTTGGTGAAGTTAATGCAGAGCAGTCGCGCTTGAAGCGCTACCCAAAAACTTGATCGCCCGCCTACCCGTACAGGTTCTAAAGCG[A/G]
ACGGAGTTTCGGAGGCACCTGCTTGTTCCGATCACCCGTGCACGCGAGATGAACAGAACCGGGGAAACAGAGAGACAGTGTAGGAACAGAAGGAGAGTAT

Reverse complement sequence

ATACTCTCCTTCTGTTCCTACACTGTCTCTCTGTTTCCCCGGTTCTGTTCATCTCGCGTGCACGGGTGATCGGAACAAGCAGGTGCCTCCGAAACTCCGT[T/C]
CGCTTTAGAACCTGTACGGGTAGGCGGGCGATCAAGTTTTTGGGTAGCGCTTCAAGCGCGACTGCTCTGCATTAACTTCACCAACATGTCGACAACCGGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.60%	2.30%	1.67%	1.40%	NA
All Indica	2759	97.90%	0.00%	0.22%	1.85%	NA
All Japonica	1512	89.30%	6.70%	3.04%	0.99%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.00%	0.00%	0.65%	NA
Indica III	913	95.40%	0.00%	0.44%	4.16%	NA
Indica Intermediate	786	98.50%	0.00%	0.25%	1.27%	NA
Temperate Japonica	767	81.60%	13.20%	4.95%	0.26%	NA
Tropical Japonica	504	99.20%	0.00%	0.60%	0.20%	NA
Japonica Intermediate	241	92.90%	0.00%	2.07%	4.98%	NA
VI/Aromatic	96	72.90%	7.30%	19.79%	0.00%	NA
Intermediate	90	91.10%	0.00%	8.89%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005384319	A -> G	LOC_Os10g09930.1	downstream_gene_variant ; 3757.0bp to feature; MODIFIER	silent_mutation	Average:55.88; most accessible tissue: Minghui63 flag leaf, score: 66.004	N	N	N	N
vg1005384319	A -> G	LOC_Os10g09940.1	downstream_gene_variant ; 1185.0bp to feature; MODIFIER	silent_mutation	Average:55.88; most accessible tissue: Minghui63 flag leaf, score: 66.004	N	N	N	N
vg1005384319	A -> G	LOC_Os10g09930-LOC_Os10g09940	intergenic_region ; MODIFIER	silent_mutation	Average:55.88; most accessible tissue: Minghui63 flag leaf, score: 66.004	N	N	N	N
vg1005384319	A -> DEL	N	N	silent_mutation	Average:55.88; most accessible tissue: Minghui63 flag leaf, score: 66.004	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005384319	3.15E-10	NA	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	2.08E-06	2.14E-10	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	7.41E-09	NA	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	8.46E-06	1.57E-07	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	8.70E-10	NA	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	3.36E-06	3.33E-10	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	1.50E-06	NA	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	2.03E-08	6.35E-09	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	1.81E-06	5.30E-12	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	1.98E-09	NA	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	NA	1.49E-09	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	7.92E-07	NA	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	NA	5.05E-08	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	1.74E-07	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	6.44E-06	NA	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	7.66E-06	7.66E-06	mr1166_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	5.81E-13	NA	mr1305_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	2.70E-09	3.52E-12	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	1.13E-07	NA	mr1409_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	5.18E-07	3.01E-08	mr1409_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	1.82E-13	2.47E-13	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	2.52E-09	2.37E-14	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	1.42E-06	NA	mr1765_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319	NA	7.71E-08	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251