\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005384319:

Variant ID: vg1005384319 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5384319
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCGGTTGTCGACATGTTGGTGAAGTTAATGCAGAGCAGTCGCGCTTGAAGCGCTACCCAAAAACTTGATCGCCCGCCTACCCGTACAGGTTCTAAAGCG[A/G]
ACGGAGTTTCGGAGGCACCTGCTTGTTCCGATCACCCGTGCACGCGAGATGAACAGAACCGGGGAAACAGAGAGACAGTGTAGGAACAGAAGGAGAGTAT

Reverse complement sequence

ATACTCTCCTTCTGTTCCTACACTGTCTCTCTGTTTCCCCGGTTCTGTTCATCTCGCGTGCACGGGTGATCGGAACAAGCAGGTGCCTCCGAAACTCCGT[T/C]
CGCTTTAGAACCTGTACGGGTAGGCGGGCGATCAAGTTTTTGGGTAGCGCTTCAAGCGCGACTGCTCTGCATTAACTTCACCAACATGTCGACAACCGGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.60% 2.30% 1.67% 1.40% NA
All Indica  2759 97.90% 0.00% 0.22% 1.85% NA
All Japonica  1512 89.30% 6.70% 3.04% 0.99% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.00% 0.00% 0.65% NA
Indica III  913 95.40% 0.00% 0.44% 4.16% NA
Indica Intermediate  786 98.50% 0.00% 0.25% 1.27% NA
Temperate Japonica  767 81.60% 13.20% 4.95% 0.26% NA
Tropical Japonica  504 99.20% 0.00% 0.60% 0.20% NA
Japonica Intermediate  241 92.90% 0.00% 2.07% 4.98% NA
VI/Aromatic  96 72.90% 7.30% 19.79% 0.00% NA
Intermediate  90 91.10% 0.00% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005384319 A -> G LOC_Os10g09930.1 downstream_gene_variant ; 3757.0bp to feature; MODIFIER silent_mutation Average:55.88; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N
vg1005384319 A -> G LOC_Os10g09940.1 downstream_gene_variant ; 1185.0bp to feature; MODIFIER silent_mutation Average:55.88; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N
vg1005384319 A -> G LOC_Os10g09930-LOC_Os10g09940 intergenic_region ; MODIFIER silent_mutation Average:55.88; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N
vg1005384319 A -> DEL N N silent_mutation Average:55.88; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005384319 3.15E-10 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 2.08E-06 2.14E-10 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 7.41E-09 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 8.46E-06 1.57E-07 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 8.70E-10 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 3.36E-06 3.33E-10 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 1.50E-06 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 2.03E-08 6.35E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 1.81E-06 5.30E-12 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 1.98E-09 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 NA 1.49E-09 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 7.92E-07 NA mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 NA 5.05E-08 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 1.74E-07 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 6.44E-06 NA mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 7.66E-06 7.66E-06 mr1166_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 5.81E-13 NA mr1305_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 2.70E-09 3.52E-12 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 1.13E-07 NA mr1409_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 5.18E-07 3.01E-08 mr1409_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 1.82E-13 2.47E-13 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 2.52E-09 2.37E-14 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 1.42E-06 NA mr1765_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005384319 NA 7.71E-08 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251