Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1005364284:

Variant ID: vg1005364284 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5364284
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCGTTGTTAATAGCAAACTGTCTCATTGCCAATCTAAACTCCTCCATGCTGGGGTATGCAGTTCCAAGATCCATGCAAGGGTTGTCAGGGTCATATGC[C/T]
ATCACATTTTCACCAGGAATTGAATCATCCACTGGAAGTGCAGCATCCATGTCATCTGGGCCTCCTACTCCAGCAACATTGACATCAGGGTCTCCTCCTT

Reverse complement sequence

AAGGAGGAGACCCTGATGTCAATGTTGCTGGAGTAGGAGGCCCAGATGACATGGATGCTGCACTTCCAGTGGATGATTCAATTCCTGGTGAAAATGTGAT[G/A]
GCATATGACCCTGACAACCCTTGCATGGATCTTGGAACTGCATACCCCAGCATGGAGGAGTTTAGATTGGCAATGAGACAGTTTGCTATTAACAACGAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.70%	0.20%	2.54%	20.59%	NA
All Indica	2759	86.60%	0.30%	2.68%	10.40%	NA
All Japonica	1512	62.90%	0.00%	1.12%	35.98%	NA
Aus	269	44.20%	0.00%	9.29%	46.47%	NA
Indica I	595	88.60%	1.30%	2.18%	7.90%	NA
Indica II	465	79.10%	0.20%	2.80%	17.85%	NA
Indica III	913	88.10%	0.00%	1.64%	10.30%	NA
Indica Intermediate	786	87.80%	0.00%	4.20%	8.02%	NA
Temperate Japonica	767	75.00%	0.00%	0.52%	24.51%	NA
Tropical Japonica	504	46.80%	0.00%	1.98%	51.19%	NA
Japonica Intermediate	241	58.10%	0.00%	1.24%	40.66%	NA
VI/Aromatic	96	93.80%	0.00%	1.04%	5.21%	NA
Intermediate	90	83.30%	0.00%	3.33%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005364284	C -> T	LOC_Os10g09900.1	missense_variant ; p.Met201Ile; MODERATE	nonsynonymous_codon ; M201I	Average:20.342; most accessible tissue: Zhenshan97 flag leaf, score: 53.034	benign	-0.086	TOLERATED	0.95
vg1005364284	C -> DEL	LOC_Os10g09900.1	N	frameshift_variant	Average:20.342; most accessible tissue: Zhenshan97 flag leaf, score: 53.034	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005364284	NA	3.16E-10	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284	NA	5.86E-06	mr1350	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284	1.23E-07	6.44E-25	mr1855	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284	1.93E-06	4.11E-22	mr1855	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284	NA	5.84E-07	mr1897	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284	NA	1.79E-08	mr1914	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284	NA	7.15E-08	mr1927	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284	NA	1.19E-09	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284	NA	5.36E-12	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284	NA	1.81E-10	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284	NA	1.92E-07	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284	5.88E-09	1.03E-29	mr1855_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284	1.68E-07	7.29E-27	mr1855_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284	NA	2.80E-07	mr1896_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284	NA	1.13E-09	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284	4.34E-06	4.53E-13	mr1914_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284	NA	1.74E-16	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284	3.92E-06	NA	mr1927_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005364284	NA	1.25E-15	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251