\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005346841:

Variant ID: vg1005346841 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 5346841
Reference Allele: CAlternative Allele: T,CT
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


GATGGAAGAAGGTTGGTGACGGGGCTGATAGATCCGGAAGGGATGCAAGAAATGGGGAGGAACTGGAGGAGTGAAGATCCCCTCGCTCACCCTCTCTCTC[C/T,CT]
CTCCAGTAGTCCACTCCCGTCTGACTGCGAGGAGTGAAGACGGCGACAGAGCTCTTCAAACTCCACCAAACCCAACGGGCAACACTTCACTAGTGTCTCT

Reverse complement sequence

AGAGACACTAGTGAAGTGTTGCCCGTTGGGTTTGGTGGAGTTTGAAGAGCTCTGTCGCCGTCTTCACTCCTCGCAGTCAGACGGGAGTGGACTACTGGAG[G/A,AG]
GAGAGAGAGGGTGAGCGAGGGGATCTTCACTCCTCCAGTTCCTCCCCATTTCTTGCATCCCTTCCGGATCTATCAGCCCCGTCACCAACCTTCTTCCATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 42.10% 0.38% 0.06% CT: 1.52%
All Indica  2759 60.30% 37.00% 0.54% 0.11% CT: 2.03%
All Japonica  1512 39.00% 59.90% 0.13% 0.00% CT: 0.99%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 59.50% 40.00% 0.34% 0.17% NA
Indica II  465 69.20% 29.20% 1.08% 0.00% CT: 0.43%
Indica III  913 59.50% 35.00% 0.33% 0.11% CT: 5.04%
Indica Intermediate  786 56.50% 41.70% 0.64% 0.13% CT: 1.02%
Temperate Japonica  767 33.80% 66.10% 0.13% 0.00% NA
Tropical Japonica  504 44.20% 55.60% 0.00% 0.00% CT: 0.20%
Japonica Intermediate  241 44.40% 49.40% 0.41% 0.00% CT: 5.81%
VI/Aromatic  96 76.00% 22.90% 0.00% 0.00% CT: 1.04%
Intermediate  90 54.40% 44.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005346841 C -> CT LOC_Os10g09870.1 5_prime_UTR_variant ; 209.0bp to feature; MODIFIER silent_mutation Average:86.407; most accessible tissue: Zhenshan97 panicle, score: 97.303 N N N N
vg1005346841 C -> CT LOC_Os10g09870.2 5_prime_UTR_variant ; 209.0bp to feature; MODIFIER silent_mutation Average:86.407; most accessible tissue: Zhenshan97 panicle, score: 97.303 N N N N
vg1005346841 C -> CT LOC_Os10g09870.4 5_prime_UTR_variant ; 209.0bp to feature; MODIFIER silent_mutation Average:86.407; most accessible tissue: Zhenshan97 panicle, score: 97.303 N N N N
vg1005346841 C -> CT LOC_Os10g09870.3 5_prime_UTR_variant ; 209.0bp to feature; MODIFIER silent_mutation Average:86.407; most accessible tissue: Zhenshan97 panicle, score: 97.303 N N N N
vg1005346841 C -> CT LOC_Os10g09880.1 upstream_gene_variant ; 4385.0bp to feature; MODIFIER silent_mutation Average:86.407; most accessible tissue: Zhenshan97 panicle, score: 97.303 N N N N
vg1005346841 C -> T LOC_Os10g09870.1 5_prime_UTR_variant ; 208.0bp to feature; MODIFIER silent_mutation Average:86.407; most accessible tissue: Zhenshan97 panicle, score: 97.303 N N N N
vg1005346841 C -> T LOC_Os10g09870.2 5_prime_UTR_variant ; 208.0bp to feature; MODIFIER silent_mutation Average:86.407; most accessible tissue: Zhenshan97 panicle, score: 97.303 N N N N
vg1005346841 C -> T LOC_Os10g09870.4 5_prime_UTR_variant ; 208.0bp to feature; MODIFIER silent_mutation Average:86.407; most accessible tissue: Zhenshan97 panicle, score: 97.303 N N N N
vg1005346841 C -> T LOC_Os10g09870.3 5_prime_UTR_variant ; 208.0bp to feature; MODIFIER silent_mutation Average:86.407; most accessible tissue: Zhenshan97 panicle, score: 97.303 N N N N
vg1005346841 C -> T LOC_Os10g09880.1 upstream_gene_variant ; 4386.0bp to feature; MODIFIER silent_mutation Average:86.407; most accessible tissue: Zhenshan97 panicle, score: 97.303 N N N N
vg1005346841 C -> DEL N N silent_mutation Average:86.407; most accessible tissue: Zhenshan97 panicle, score: 97.303 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1005346841 C CT -0.13 -0.17 -0.12 0.0 -0.03 -0.06
vg1005346841 C T 0.0 0.01 0.0 0.01 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005346841 NA 5.75E-06 mr1709 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005346841 4.24E-07 NA mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005346841 NA 1.14E-08 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005346841 NA 9.00E-08 mr1835 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005346841 NA 9.30E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005346841 NA 8.62E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005346841 NA 1.55E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005346841 3.51E-07 NA mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005346841 NA 2.24E-08 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251