Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005318826:

Variant ID: vg1005318826 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5318826
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

CAAGTAGTAGTAATGAGTTTGTAGTTAGTGGCCAATTAAAGTAATTAATAAGAGAGTTGTTTTACACTTGTACACTTTTCGGGAAAAATACACGAGTACT[A/G]
GTGTCGTACTAGTCGTGGCTGTACTTTTATTTTTCGAAGTGTAGTAGTATTTGGTTGTCTCTGCAAGCGATATTTGAAGTCGGATGGGCCACGTTCAGCC

Reverse complement sequence

GGCTGAACGTGGCCCATCCGACTTCAAATATCGCTTGCAGAGACAACCAAATACTACTACACTTCGAAAAATAAAAGTACAGCCACGACTAGTACGACAC[T/C]
AGTACTCGTGTATTTTTCCCGAAAAGTGTACAAGTGTAAAACAACTCTCTTATTAATTACTTTAATTGGCCACTAACTACAAACTCATTACTACTACTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.70%	30.10%	0.17%	0.00%	NA
All Indica	2759	91.40%	8.40%	0.11%	0.00%	NA
All Japonica	1512	24.70%	75.00%	0.33%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	87.30%	12.30%	0.43%	0.00%	NA
Indica III	913	85.80%	14.20%	0.00%	0.00%	NA
Indica Intermediate	786	94.30%	5.70%	0.00%	0.00%	NA
Temperate Japonica	767	27.80%	71.80%	0.39%	0.00%	NA
Tropical Japonica	504	21.20%	78.60%	0.20%	0.00%	NA
Japonica Intermediate	241	22.00%	77.60%	0.41%	0.00%	NA
VI/Aromatic	96	70.80%	29.20%	0.00%	0.00%	NA
Intermediate	90	67.80%	32.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005318826	A -> G	LOC_Os10g09820.1	upstream_gene_variant ; 191.0bp to feature; MODIFIER	silent_mutation	Average:84.391; most accessible tissue: Callus, score: 95.43	N	N	N	N
vg1005318826	A -> G	LOC_Os10g09830.1	upstream_gene_variant ; 1763.0bp to feature; MODIFIER	silent_mutation	Average:84.391; most accessible tissue: Callus, score: 95.43	N	N	N	N
vg1005318826	A -> G	LOC_Os10g09820-LOC_Os10g09830	intergenic_region ; MODIFIER	silent_mutation	Average:84.391; most accessible tissue: Callus, score: 95.43	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1005318826	A	G	-0.02	-0.03	-0.02	-0.01	-0.03	-0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005318826	NA	1.78E-06	mr1709	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826	4.74E-07	3.47E-18	mr1768	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826	5.01E-07	5.00E-07	mr1166_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826	NA	6.80E-07	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826	NA	4.06E-07	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826	NA	1.12E-08	mr1409_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826	7.85E-06	7.85E-06	mr1547_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826	NA	9.58E-08	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826	NA	5.14E-07	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826	NA	2.06E-11	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826	NA	2.56E-06	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826	1.44E-08	6.74E-30	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826	NA	9.61E-06	mr1768_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826	NA	2.83E-07	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251