\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005318826:

Variant ID: vg1005318826 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5318826
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGTAGTAGTAATGAGTTTGTAGTTAGTGGCCAATTAAAGTAATTAATAAGAGAGTTGTTTTACACTTGTACACTTTTCGGGAAAAATACACGAGTACT[A/G]
GTGTCGTACTAGTCGTGGCTGTACTTTTATTTTTCGAAGTGTAGTAGTATTTGGTTGTCTCTGCAAGCGATATTTGAAGTCGGATGGGCCACGTTCAGCC

Reverse complement sequence

GGCTGAACGTGGCCCATCCGACTTCAAATATCGCTTGCAGAGACAACCAAATACTACTACACTTCGAAAAATAAAAGTACAGCCACGACTAGTACGACAC[T/C]
AGTACTCGTGTATTTTTCCCGAAAAGTGTACAAGTGTAAAACAACTCTCTTATTAATTACTTTAATTGGCCACTAACTACAAACTCATTACTACTACTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.70% 30.10% 0.17% 0.00% NA
All Indica  2759 91.40% 8.40% 0.11% 0.00% NA
All Japonica  1512 24.70% 75.00% 0.33% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 87.30% 12.30% 0.43% 0.00% NA
Indica III  913 85.80% 14.20% 0.00% 0.00% NA
Indica Intermediate  786 94.30% 5.70% 0.00% 0.00% NA
Temperate Japonica  767 27.80% 71.80% 0.39% 0.00% NA
Tropical Japonica  504 21.20% 78.60% 0.20% 0.00% NA
Japonica Intermediate  241 22.00% 77.60% 0.41% 0.00% NA
VI/Aromatic  96 70.80% 29.20% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005318826 A -> G LOC_Os10g09820.1 upstream_gene_variant ; 191.0bp to feature; MODIFIER silent_mutation Average:84.391; most accessible tissue: Callus, score: 95.43 N N N N
vg1005318826 A -> G LOC_Os10g09830.1 upstream_gene_variant ; 1763.0bp to feature; MODIFIER silent_mutation Average:84.391; most accessible tissue: Callus, score: 95.43 N N N N
vg1005318826 A -> G LOC_Os10g09820-LOC_Os10g09830 intergenic_region ; MODIFIER silent_mutation Average:84.391; most accessible tissue: Callus, score: 95.43 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1005318826 A G -0.02 -0.03 -0.02 -0.01 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005318826 NA 1.78E-06 mr1709 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826 4.74E-07 3.47E-18 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826 5.01E-07 5.00E-07 mr1166_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826 NA 6.80E-07 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826 NA 4.06E-07 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826 NA 1.12E-08 mr1409_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826 7.85E-06 7.85E-06 mr1547_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826 NA 9.58E-08 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826 NA 5.14E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826 NA 2.06E-11 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826 NA 2.56E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826 1.44E-08 6.74E-30 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826 NA 9.61E-06 mr1768_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318826 NA 2.83E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251