\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005318536:

Variant ID: vg1005318536 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5318536
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.24, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


TCGTTGATGAAGTCCATGGGCGGCCTACGTTGCTCGATCTTGCCGCGGAGGTAGAAGTCGACGAGCTCCTCATCCGAGGGCACGAAGTGGTAGCCTGGAG[G/A]
CAATCGTAGCTTCGGCACCAGCTCGTGTCTCCGCCGGCCTCCATTGCTCGCCGTCGTCGCCGCCGCCGAGCTGTTGCCGCCATTGCTCTCCGCTGTCATC

Reverse complement sequence

GATGACAGCGGAGAGCAATGGCGGCAACAGCTCGGCGGCGGCGACGACGGCGAGCAATGGAGGCCGGCGGAGACACGAGCTGGTGCCGAAGCTACGATTG[C/T]
CTCCAGGCTACCACTTCGTGCCCTCGGATGAGGAGCTCGTCGACTTCTACCTCCGCGGCAAGATCGAGCAACGTAGGCCGCCCATGGACTTCATCAACGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 31.90% 0.08% 0.02% NA
All Indica  2759 91.40% 8.60% 0.07% 0.00% NA
All Japonica  1512 19.40% 80.40% 0.13% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 87.10% 12.70% 0.22% 0.00% NA
Indica III  913 85.70% 14.30% 0.00% 0.00% NA
Indica Intermediate  786 94.30% 5.70% 0.00% 0.00% NA
Temperate Japonica  767 17.60% 82.00% 0.26% 0.13% NA
Tropical Japonica  504 21.00% 79.00% 0.00% 0.00% NA
Japonica Intermediate  241 21.60% 78.40% 0.00% 0.00% NA
VI/Aromatic  96 70.80% 29.20% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005318536 G -> A LOC_Os10g09820.1 missense_variant ; p.Pro34Ser; MODERATE nonsynonymous_codon ; P34S Average:66.848; most accessible tissue: Zhenshan97 panicle, score: 85.665 benign -0.226 TOLERATED 0.15
vg1005318536 G -> DEL LOC_Os10g09820.1 N frameshift_variant Average:66.848; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1005318536 G A -0.01 -0.02 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005318536 NA 6.81E-12 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318536 NA 2.10E-10 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318536 NA 1.13E-09 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318536 NA 5.17E-12 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318536 NA 2.37E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318536 NA 3.45E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318536 NA 1.68E-11 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318536 NA 1.88E-11 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318536 4.24E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318536 NA 1.48E-12 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318536 5.59E-06 6.42E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318536 4.76E-06 1.34E-08 mr1379_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318536 NA 1.37E-07 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318536 9.74E-07 9.74E-07 mr1547_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318536 5.97E-07 8.71E-10 mr1559_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318536 4.49E-06 NA mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318536 NA 7.24E-06 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318536 NA 7.39E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318536 NA 3.69E-06 mr1768_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005318536 NA 1.95E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251