\
| Variant ID: vg1005306011 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5306011 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.08, others allele: 0.00, population size: 113. )
ATTCTAGTTTGTGAATTTCTGGGCGTGACATACCTCCCCCACTTCATCTTGCATAGTTGTCGGTAATGATTCCCTCCTTCCTATCACTGCAACTGGTAGC[A/G]
CTCGAATCAATTACCCACACAATTCCTTTCTTCTTAATAATGTCCTTGTTTCTCCTGCCATTATTAAAAGCCTTATATCTGCTCGCCGTTTTACTCGTGG
CCACGAGTAAAACGGCGAGCAGATATAAGGCTTTTAATAATGGCAGGAGAAACAAGGACATTATTAAGAAGAAAGGAATTGTGTGGGTAATTGATTCGAG[T/C]
GCTACCAGTTGCAGTGATAGGAAGGAGGGAATCATTACCGACAACTATGCAAGATGAAGTGGGGGAGGTATGTCACGCCCAGAAATTCACAAACTAGAAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.80% | 39.40% | 0.53% | 8.27% | NA |
| All Indica | 2759 | 45.70% | 49.10% | 0.65% | 4.53% | NA |
| All Japonica | 1512 | 71.60% | 13.20% | 0.26% | 15.01% | NA |
| Aus | 269 | 1.90% | 98.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 60.00% | 39.50% | 0.50% | 0.00% | NA |
| Indica II | 465 | 41.10% | 48.00% | 1.08% | 9.89% | NA |
| Indica III | 913 | 44.10% | 49.00% | 0.55% | 6.35% | NA |
| Indica Intermediate | 786 | 39.60% | 57.10% | 0.64% | 2.67% | NA |
| Temperate Japonica | 767 | 74.10% | 16.30% | 0.13% | 9.52% | NA |
| Tropical Japonica | 504 | 71.40% | 9.50% | 0.60% | 18.45% | NA |
| Japonica Intermediate | 241 | 63.90% | 10.80% | 0.00% | 25.31% | NA |
| VI/Aromatic | 96 | 42.70% | 27.10% | 1.04% | 29.17% | NA |
| Intermediate | 90 | 62.20% | 23.30% | 2.22% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005306011 | A -> G | LOC_Os10g09800.1 | downstream_gene_variant ; 3824.0bp to feature; MODIFIER | silent_mutation | Average:34.625; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg1005306011 | A -> G | LOC_Os10g09810.1 | intron_variant ; MODIFIER | silent_mutation | Average:34.625; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg1005306011 | A -> DEL | N | N | silent_mutation | Average:34.625; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005306011 | NA | 2.71E-06 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005306011 | NA | 1.35E-07 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005306011 | NA | 3.08E-07 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005306011 | NA | 7.95E-08 | mr1556 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005306011 | NA | 2.30E-06 | mr1569 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005306011 | NA | 3.53E-06 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005306011 | NA | 3.02E-07 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005306011 | NA | 4.75E-09 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005306011 | NA | 5.00E-06 | mr1687 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005306011 | NA | 4.38E-07 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005306011 | 3.40E-06 | 3.04E-07 | mr1976 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |