Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005297414:

Variant ID: vg1005297414 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5297414
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


AAATAACCAAGGGCAGCAAACCGGCAGAGCAAGCTACCGCTTTTCTCGCCACCGGTGGCTCTGGTGGCGCCTAGGCTACCGGCAGCAATGGCGGCTCCGG[C/T]
AGCAGCTCCGGTAGCGGCTCCGGCGGCGGCAACTCCGGCAACTCGTGCAACCGCCGTCGTGGTCGTGGCAACAACAGCGGCAACACTGGCAACGTCGGCG

Reverse complement sequence

CGCCGACGTTGCCAGTGTTGCCGCTGTTGTTGCCACGACCACGACGGCGGTTGCACGAGTTGCCGGAGTTGCCGCCGCCGGAGCCGCTACCGGAGCTGCT[G/A]
CCGGAGCCGCCATTGCTGCCGGTAGCCTAGGCGCCACCAGAGCCACCGGTGGCGAGAAAAGCGGTAGCTTGCTCTGCCGGTTTGCTGCCCTTGGTTATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.00% 1.10% 0.04% 8.91% NA
All Indica  2759 94.80% 0.30% 0.00% 4.89% NA
All Japonica  1512 80.90% 2.60% 0.07% 16.47% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 89.50% 0.00% 0.00% 10.54% NA
Indica III  913 92.60% 0.80% 0.00% 6.68% NA
Indica Intermediate  786 96.80% 0.00% 0.00% 3.18% NA
Temperate Japonica  767 89.60% 0.00% 0.00% 10.43% NA
Tropical Japonica  504 72.60% 7.50% 0.00% 19.84% NA
Japonica Intermediate  241 70.50% 0.40% 0.41% 28.63% NA
VI/Aromatic  96 68.80% 1.00% 0.00% 30.21% NA
Intermediate  90 87.80% 2.20% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005297414 C -> T LOC_Os10g09800.1 upstream_gene_variant ; 2831.0bp to feature; MODIFIER silent_mutation Average:34.828; most accessible tissue: Zhenshan97 flag leaf, score: 83.84 N N N N
vg1005297414 C -> T LOC_Os10g09790.1 downstream_gene_variant ; 429.0bp to feature; MODIFIER silent_mutation Average:34.828; most accessible tissue: Zhenshan97 flag leaf, score: 83.84 N N N N
vg1005297414 C -> T LOC_Os10g09790-LOC_Os10g09800 intergenic_region ; MODIFIER silent_mutation Average:34.828; most accessible tissue: Zhenshan97 flag leaf, score: 83.84 N N N N
vg1005297414 C -> DEL N N silent_mutation Average:34.828; most accessible tissue: Zhenshan97 flag leaf, score: 83.84 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1005297414 C T -0.01 -0.01 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005297414 NA 8.13E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005297414 NA 4.37E-07 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005297414 NA 1.26E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005297414 NA 3.96E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005297414 NA 8.89E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005297414 NA 1.53E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005297414 NA 2.49E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005297414 NA 3.65E-06 mr1485 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005297414 NA 6.92E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005297414 NA 7.56E-08 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005297414 NA 5.66E-08 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005297414 NA 1.87E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005297414 NA 1.74E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005297414 NA 1.54E-08 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005297414 NA 1.32E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005297414 NA 3.68E-08 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005297414 NA 5.50E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005297414 NA 3.76E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005297414 7.97E-06 2.88E-06 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005297414 NA 1.12E-08 mr1986 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005297414 NA 1.75E-06 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251