\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005271470:

Variant ID: vg1005271470 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5271470
Reference Allele: GAlternative Allele: C,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, G: 0.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTGCCGGCTGGCTACCTCCTTCGAGCGATCGACGCTAGCTGATGCTGATCAGGCTAGTAAATCCGCAACTAAATTAACTAACCGCATGTGTCGCTAAC[G/C,T]
AACAGCACGAGGTTTTATGGGCTCGAGGAGCCTGTCCAAAATGTAGTGCTTGGCCGGTCCATTTGATTTAGAGAGTATATACCACTGTGTTTGGCATGTT

Reverse complement sequence

AACATGCCAAACACAGTGGTATATACTCTCTAAATCAAATGGACCGGCCAAGCACTACATTTTGGACAGGCTCCTCGAGCCCATAAAACCTCGTGCTGTT[C/G,A]
GTTAGCGACACATGCGGTTAGTTAATTTAGTTGCGGATTTACTAGCCTGATCAGCATCAGCTAGCGTCGATCGCTCGAAGGAGGTAGCCAGCCGGCAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.60% 28.30% 0.00% 0.00% T: 0.02%
All Indica  2759 93.20% 6.80% 0.00% 0.00% NA
All Japonica  1512 27.80% 72.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 87.10% 12.90% 0.00% 0.00% NA
Indica III  913 91.20% 8.80% 0.00% 0.00% NA
Indica Intermediate  786 94.30% 5.70% 0.00% 0.00% NA
Temperate Japonica  767 28.20% 71.80% 0.00% 0.00% NA
Tropical Japonica  504 29.40% 70.60% 0.00% 0.00% NA
Japonica Intermediate  241 23.20% 76.80% 0.00% 0.00% NA
VI/Aromatic  96 70.80% 29.20% 0.00% 0.00% NA
Intermediate  90 63.30% 35.60% 0.00% 0.00% T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005271470 G -> C LOC_Os10g09740.1 upstream_gene_variant ; 709.0bp to feature; MODIFIER silent_mutation Average:73.157; most accessible tissue: Callus, score: 87.127 N N N N
vg1005271470 G -> C LOC_Os10g09750.1 upstream_gene_variant ; 3900.0bp to feature; MODIFIER silent_mutation Average:73.157; most accessible tissue: Callus, score: 87.127 N N N N
vg1005271470 G -> C LOC_Os10g09740-LOC_Os10g09750 intergenic_region ; MODIFIER silent_mutation Average:73.157; most accessible tissue: Callus, score: 87.127 N N N N
vg1005271470 G -> T LOC_Os10g09740.1 upstream_gene_variant ; 709.0bp to feature; MODIFIER silent_mutation Average:73.157; most accessible tissue: Callus, score: 87.127 N N N N
vg1005271470 G -> T LOC_Os10g09750.1 upstream_gene_variant ; 3900.0bp to feature; MODIFIER silent_mutation Average:73.157; most accessible tissue: Callus, score: 87.127 N N N N
vg1005271470 G -> T LOC_Os10g09740-LOC_Os10g09750 intergenic_region ; MODIFIER silent_mutation Average:73.157; most accessible tissue: Callus, score: 87.127 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005271470 NA 2.05E-12 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 NA 1.89E-11 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 NA 2.62E-10 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 NA 6.98E-13 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 NA 3.01E-11 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 NA 1.72E-10 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 NA 3.83E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 NA 3.21E-12 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 NA 2.27E-07 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 NA 3.99E-12 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 NA 2.22E-10 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 NA 2.69E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 NA 1.30E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 6.39E-06 NA mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 NA 8.71E-14 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 2.20E-07 2.20E-07 mr1166_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 1.07E-06 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 3.58E-06 2.64E-07 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 NA 8.07E-08 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 NA 5.84E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 NA 2.32E-08 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 NA 1.53E-11 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 3.43E-06 3.43E-06 mr1547_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 NA 1.38E-08 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 1.75E-06 NA mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 7.43E-06 3.98E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 NA 8.88E-06 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 NA 4.39E-07 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 7.04E-08 4.48E-29 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005271470 NA 2.22E-06 mr1768_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251