\
| Variant ID: vg1005270327 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5270327 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.77, G: 0.23, others allele: 0.00, population size: 43. )
ATTTTCTTTGCTCCCTATTAGTAACAGCAACCGGTACCAACCGGGACAAAAAGATTGATTATTTCAACCGAGACTAGTCCTGGATTGCTACTCCCGGTTG[A/G]
AAAACCGAGACTAAAAGGGGTTAACAACCGGGAGTAAAAATAGTTTCTCCACCAGTGGATGGACCTGTATATCCCCCGACGTGAAGGCCACGGAATGGAG
CTCCATTCCGTGGCCTTCACGTCGGGGGATATACAGGTCCATCCACTGGTGGAGAAACTATTTTTACTCCCGGTTGTTAACCCCTTTTAGTCTCGGTTTT[T/C]
CAACCGGGAGTAGCAATCCAGGACTAGTCTCGGTTGAAATAATCAATCTTTTTGTCCCGGTTGGTACCGGTTGCTGTTACTAATAGGGAGCAAAGAAAAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.20% | 41.30% | 0.40% | 4.08% | NA |
| All Indica | 2759 | 41.40% | 58.00% | 0.25% | 0.36% | NA |
| All Japonica | 1512 | 86.20% | 3.40% | 0.40% | 9.99% | NA |
| Aus | 269 | 3.70% | 94.40% | 1.49% | 0.37% | NA |
| Indica I | 595 | 21.30% | 78.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 51.20% | 48.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 53.20% | 45.90% | 0.22% | 0.66% | NA |
| Indica Intermediate | 786 | 37.20% | 62.00% | 0.38% | 0.51% | NA |
| Temperate Japonica | 767 | 78.70% | 3.50% | 0.65% | 17.08% | NA |
| Tropical Japonica | 504 | 97.00% | 2.00% | 0.20% | 0.79% | NA |
| Japonica Intermediate | 241 | 87.60% | 5.80% | 0.00% | 6.64% | NA |
| VI/Aromatic | 96 | 50.00% | 24.00% | 1.04% | 25.00% | NA |
| Intermediate | 90 | 64.40% | 26.70% | 1.11% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005270327 | A -> G | LOC_Os10g09740.1 | intron_variant ; MODIFIER | silent_mutation | Average:65.079; most accessible tissue: Zhenshan97 young leaf, score: 87.443 | N | N | N | N |
| vg1005270327 | A -> DEL | N | N | silent_mutation | Average:65.079; most accessible tissue: Zhenshan97 young leaf, score: 87.443 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005270327 | NA | 2.08E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005270327 | 3.81E-07 | 1.20E-09 | mr1300 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005270327 | NA | 6.82E-07 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005270327 | NA | 2.00E-07 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005270327 | NA | 1.29E-06 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005270327 | NA | 3.63E-09 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005270327 | NA | 6.58E-09 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005270327 | NA | 4.42E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005270327 | NA | 2.55E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005270327 | NA | 1.08E-07 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005270327 | 9.64E-06 | NA | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005270327 | NA | 1.42E-07 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005270327 | 9.25E-06 | 3.70E-08 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005270327 | NA | 1.77E-09 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005270327 | NA | 1.14E-08 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005270327 | NA | 4.92E-06 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005270327 | NA | 6.75E-06 | mr1942_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |