\
| Variant ID: vg1005268365 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5268365 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.55, A: 0.41, T: 0.03, others allele: 0.00, population size: 58. )
ACAAACAAAAAAAATTATCATAATATAATCATGTAAGATCTTGTTGTATAGATTTAATTGTAGGGAACACAACGGTATAATTGGATCATAGATCAGATAA[A/G]
TAATTTAAGAGAATATTTTATTTGAAATAATGAGGATGCAAGTGGCAGGTGCTAGGCATTCATTAAAGTCACTTTCTTTTTTTATAAGTTACTTCTATAA
TTATAGAAGTAACTTATAAAAAAAGAAAGTGACTTTAATGAATGCCTAGCACCTGCCACTTGCATCCTCATTATTTCAAATAAAATATTCTCTTAAATTA[T/C]
TTATCTGATCTATGATCCAATTATACCGTTGTGTTCCCTACAATTAAATCTATACAACAAGATCTTACATGATTATATTATGATAATTTTTTTTGTTTGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.20% | 41.60% | 0.17% | 4.10% | NA |
| All Indica | 2759 | 41.50% | 58.10% | 0.14% | 0.33% | NA |
| All Japonica | 1512 | 86.20% | 3.40% | 0.26% | 10.12% | NA |
| Aus | 269 | 3.30% | 96.30% | 0.00% | 0.37% | NA |
| Indica I | 595 | 21.30% | 78.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 51.20% | 48.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 53.20% | 46.00% | 0.22% | 0.55% | NA |
| Indica Intermediate | 786 | 37.30% | 62.10% | 0.13% | 0.51% | NA |
| Temperate Japonica | 767 | 78.60% | 3.50% | 0.52% | 17.34% | NA |
| Tropical Japonica | 504 | 97.00% | 2.20% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 87.60% | 5.80% | 0.00% | 6.64% | NA |
| VI/Aromatic | 96 | 47.90% | 27.10% | 0.00% | 25.00% | NA |
| Intermediate | 90 | 64.40% | 27.80% | 0.00% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005268365 | A -> G | LOC_Os10g09740.1 | downstream_gene_variant ; 758.0bp to feature; MODIFIER | silent_mutation | Average:19.101; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1005268365 | A -> G | LOC_Os10g09710-LOC_Os10g09740 | intergenic_region ; MODIFIER | silent_mutation | Average:19.101; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1005268365 | A -> DEL | N | N | silent_mutation | Average:19.101; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005268365 | NA | 7.10E-09 | mr1050 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005268365 | NA | 1.45E-07 | mr1222 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005268365 | NA | 5.75E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005268365 | NA | 7.84E-06 | mr1308 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005268365 | NA | 5.65E-07 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005268365 | NA | 2.83E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005268365 | NA | 7.07E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005268365 | NA | 1.23E-09 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005268365 | NA | 5.12E-07 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005268365 | NA | 1.27E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005268365 | NA | 2.09E-07 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005268365 | NA | 8.49E-06 | mr1832 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005268365 | NA | 2.72E-10 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005268365 | NA | 8.52E-09 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005268365 | 7.46E-07 | 7.46E-07 | mr1281_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |