| Variant ID: vg1005213274 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5213274 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, A: 0.28, others allele: 0.00, population size: 32. )
CACAAGCTAGGTGTAACTGTCCTGGAAACCGCTTTAACTACCACAACCGTCATAAGGACCCACCAGTCAGTGACCCAGAGAAGTGTGGAGGCCTTCTGGG[C/A]
CAGCCCAGGTTCGGCCAAACCCTGGCTGCGTCTGCTCAGGTTGGCTCTGCACGTGGACGATCGGGATGGCTTGCTGATGGCGGTTGCAAGGGCAAAATGG
CCATTTTGCCCTTGCAACCGCCATCAGCAAGCCATCCCGATCGTCCACGTGCAGAGCCAACCTGAGCAGACGCAGCCAGGGTTTGGCCGAACCTGGGCTG[G/T]
CCCAGAAGGCCTCCACACTTCTCTGGGTCACTGACTGGTGGGTCCTTATGACGGTTGTGGTAGTTAAAGCGGTTTCCAGGACAGTTACACCTAGCTTGTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.30% | 31.90% | 0.28% | 3.49% | NA |
| All Indica | 2759 | 89.10% | 10.30% | 0.11% | 0.51% | NA |
| All Japonica | 1512 | 15.80% | 75.60% | 0.53% | 8.07% | NA |
| Aus | 269 | 98.10% | 1.10% | 0.37% | 0.37% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 86.00% | 13.50% | 0.00% | 0.43% | NA |
| Indica III | 913 | 82.40% | 16.80% | 0.11% | 0.77% | NA |
| Indica Intermediate | 786 | 91.20% | 7.90% | 0.25% | 0.64% | NA |
| Temperate Japonica | 767 | 7.60% | 78.90% | 0.52% | 13.04% | NA |
| Tropical Japonica | 504 | 28.40% | 70.00% | 0.40% | 1.19% | NA |
| Japonica Intermediate | 241 | 15.80% | 76.80% | 0.83% | 6.64% | NA |
| VI/Aromatic | 96 | 30.20% | 46.90% | 1.04% | 21.88% | NA |
| Intermediate | 90 | 55.60% | 36.70% | 0.00% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005213274 | C -> A | LOC_Os10g09630.1 | synonymous_variant ; p.Gly36Gly; LOW | synonymous_codon | Average:48.006; most accessible tissue: Zhenshan97 young leaf, score: 72.747 | N | N | N | N |
| vg1005213274 | C -> DEL | LOC_Os10g09630.1 | N | frameshift_variant | Average:48.006; most accessible tissue: Zhenshan97 young leaf, score: 72.747 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005213274 | NA | 5.38E-12 | mr1016 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005213274 | NA | 4.71E-11 | mr1017 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005213274 | NA | 4.63E-09 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005213274 | NA | 4.49E-12 | mr1055 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005213274 | NA | 1.26E-11 | mr1079 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005213274 | NA | 8.14E-11 | mr1132 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005213274 | NA | 1.96E-10 | mr1142 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005213274 | NA | 7.08E-07 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005213274 | NA | 5.15E-13 | mr1390 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005213274 | NA | 9.95E-13 | mr1490 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/