\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005213274:

Variant ID: vg1005213274 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5213274
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, A: 0.28, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:


CACAAGCTAGGTGTAACTGTCCTGGAAACCGCTTTAACTACCACAACCGTCATAAGGACCCACCAGTCAGTGACCCAGAGAAGTGTGGAGGCCTTCTGGG[C/A]
CAGCCCAGGTTCGGCCAAACCCTGGCTGCGTCTGCTCAGGTTGGCTCTGCACGTGGACGATCGGGATGGCTTGCTGATGGCGGTTGCAAGGGCAAAATGG

Reverse complement sequence

CCATTTTGCCCTTGCAACCGCCATCAGCAAGCCATCCCGATCGTCCACGTGCAGAGCCAACCTGAGCAGACGCAGCCAGGGTTTGGCCGAACCTGGGCTG[G/T]
CCCAGAAGGCCTCCACACTTCTCTGGGTCACTGACTGGTGGGTCCTTATGACGGTTGTGGTAGTTAAAGCGGTTTCCAGGACAGTTACACCTAGCTTGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 31.90% 0.28% 3.49% NA
All Indica  2759 89.10% 10.30% 0.11% 0.51% NA
All Japonica  1512 15.80% 75.60% 0.53% 8.07% NA
Aus  269 98.10% 1.10% 0.37% 0.37% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 86.00% 13.50% 0.00% 0.43% NA
Indica III  913 82.40% 16.80% 0.11% 0.77% NA
Indica Intermediate  786 91.20% 7.90% 0.25% 0.64% NA
Temperate Japonica  767 7.60% 78.90% 0.52% 13.04% NA
Tropical Japonica  504 28.40% 70.00% 0.40% 1.19% NA
Japonica Intermediate  241 15.80% 76.80% 0.83% 6.64% NA
VI/Aromatic  96 30.20% 46.90% 1.04% 21.88% NA
Intermediate  90 55.60% 36.70% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005213274 C -> A LOC_Os10g09630.1 synonymous_variant ; p.Gly36Gly; LOW synonymous_codon Average:48.006; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N
vg1005213274 C -> DEL LOC_Os10g09630.1 N frameshift_variant Average:48.006; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005213274 NA 5.38E-12 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005213274 NA 4.71E-11 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005213274 NA 4.63E-09 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005213274 NA 4.49E-12 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005213274 NA 1.26E-11 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005213274 NA 8.14E-11 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005213274 NA 1.96E-10 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005213274 NA 7.08E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005213274 NA 5.15E-13 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005213274 NA 9.95E-13 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005213274 NA 3.34E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005213274 NA 5.19E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005213274 NA 1.63E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005213274 NA 1.59E-09 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005213274 NA 6.62E-14 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005213274 NA 4.04E-12 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005213274 NA 7.52E-07 mr1182_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005213274 NA 4.23E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005213274 NA 4.24E-09 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005213274 NA 6.84E-12 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251