\
| Variant ID: vg1005203428 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5203428 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TGTAATATTGTTATACTCCCTCCATATTTTAATGTATGACGCCGTTAACTTTTTAACCAACGTTTGACCATTCATCTTATTCAAAAATTTTATGCAAATA[T/C]
AAAAATACTTATGTCATGCTTAAAGAGCATTTGATGATAAATCAAGTCACAATAAAATAAATTATAATTACATAAAATTTTTGAATAAAACGAAAGGTCA
TGACCTTTCGTTTTATTCAAAAATTTTATGTAATTATAATTTATTTTATTGTGACTTGATTTATCATCAAATGCTCTTTAAGCATGACATAAGTATTTTT[A/G]
TATTTGCATAAAATTTTTGAATAAGATGAATGGTCAAACGTTGGTTAAAAAGTTAACGGCGTCATACATTAAAATATGGAGGGAGTATAACAATATTACA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.30% | 0.40% | 1.65% | 64.62% | NA |
| All Indica | 2759 | 12.00% | 0.70% | 0.94% | 86.34% | NA |
| All Japonica | 1512 | 76.70% | 0.00% | 3.11% | 20.24% | NA |
| Aus | 269 | 0.70% | 0.40% | 0.00% | 98.88% | NA |
| Indica I | 595 | 3.20% | 1.30% | 0.00% | 95.46% | NA |
| Indica II | 465 | 16.30% | 0.20% | 0.86% | 82.58% | NA |
| Indica III | 913 | 17.60% | 0.90% | 1.53% | 79.96% | NA |
| Indica Intermediate | 786 | 9.70% | 0.30% | 1.02% | 89.06% | NA |
| Temperate Japonica | 767 | 80.20% | 0.00% | 0.13% | 19.69% | NA |
| Tropical Japonica | 504 | 70.80% | 0.00% | 8.93% | 20.24% | NA |
| Japonica Intermediate | 241 | 77.60% | 0.00% | 0.41% | 21.99% | NA |
| VI/Aromatic | 96 | 46.90% | 0.00% | 3.12% | 50.00% | NA |
| Intermediate | 90 | 40.00% | 0.00% | 2.22% | 57.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005203428 | T -> C | LOC_Os10g09620.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.331; most accessible tissue: Minghui63 root, score: 73.351 | N | N | N | N |
| vg1005203428 | T -> DEL | N | N | silent_mutation | Average:47.331; most accessible tissue: Minghui63 root, score: 73.351 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005203428 | NA | 8.59E-08 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005203428 | NA | 7.80E-06 | mr1608 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005203428 | 8.24E-06 | NA | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005203428 | 2.76E-06 | 2.76E-06 | mr1758 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005203428 | NA | 1.47E-06 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005203428 | NA | 9.40E-08 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005203428 | NA | 4.89E-07 | mr1401_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005203428 | NA | 3.08E-06 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |