\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005181911:

Variant ID: vg1005181911 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5181911
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TCGTCCAAGGATCGCCGCCGAAGTCGTCCCCTCGCCGTTCGTCTCCGACGTTCCCGGCCGTCTCCGCCGCGCCCGTTCGTCGTTGTCGTTCCCACGCCTC[G/A]
TCGCGTGGTGGTAAGGATCTCTCCTCTTGCTGCCCTGTCCTCGTCCTTTCGGTGTCGCCCCGTACCCGTTGTGCGGTTGTTGACCCTGGTACCTGTGTAC

Reverse complement sequence

GTACACAGGTACCAGGGTCAACAACCGCACAACGGGTACGGGGCGACACCGAAAGGACGAGGACAGGGCAGCAAGAGGAGAGATCCTTACCACCACGCGA[C/T]
GAGGCGTGGGAACGACAACGACGAACGGGCGCGGCGGAGACGGCCGGGAACGTCGGAGACGAACGGCGAGGGGACGACTTCGGCGGCGATCCTTGGACGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.20% 8.60% 19.87% 32.37% NA
All Indica  2759 17.50% 6.70% 29.32% 46.54% NA
All Japonica  1512 72.40% 14.00% 2.91% 10.71% NA
Aus  269 57.60% 0.00% 23.05% 19.33% NA
Indica I  595 8.20% 0.30% 27.73% 63.70% NA
Indica II  465 12.30% 12.30% 22.15% 53.33% NA
Indica III  913 25.10% 10.30% 31.22% 33.41% NA
Indica Intermediate  786 18.70% 3.90% 32.57% 44.78% NA
Temperate Japonica  767 87.60% 6.00% 1.83% 4.56% NA
Tropical Japonica  504 56.00% 20.20% 4.96% 18.85% NA
Japonica Intermediate  241 58.10% 26.60% 2.07% 13.28% NA
VI/Aromatic  96 80.20% 6.20% 6.25% 7.29% NA
Intermediate  90 47.80% 4.40% 20.00% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005181911 G -> A LOC_Os10g09590.1 upstream_gene_variant ; 448.0bp to feature; MODIFIER silent_mutation Average:43.967; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N
vg1005181911 G -> A LOC_Os10g09590-LOC_Os10g09600 intergenic_region ; MODIFIER silent_mutation Average:43.967; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N
vg1005181911 G -> DEL N N silent_mutation Average:43.967; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005181911 NA 2.23E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 3.54E-15 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 1.44E-13 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 1.23E-13 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 7.04E-11 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 1.26E-14 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 3.64E-13 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 2.67E-12 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 3.38E-12 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 9.82E-14 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 1.44E-13 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 3.12E-08 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 6.70E-13 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 1.49E-12 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 4.97E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 2.49E-16 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 3.09E-11 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 6.87E-17 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 7.19E-08 NA mr1071_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 2.18E-15 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 1.47E-06 NA mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 3.96E-08 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 3.59E-13 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 4.34E-15 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 4.61E-07 NA mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 1.89E-15 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 4.98E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 2.38E-14 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 2.04E-08 NA mr1613_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005181911 NA 8.14E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251