\
| Variant ID: vg1005176953 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5176953 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.04, others allele: 0.00, population size: 45. )
CCAACAATTATAGCTTGGCATGAACCCCGACTCAAACAATTATAGCTTGGCATGAACCCCGACTCAAACAAGTGGAAATGAATAGTCCTGGATGCAGAAT[A/G]
CTTCTTCTGGTTCTTACACTTGTTGCATGGACAACAAATAAAACCGTTACGCTTGTTATCTTCGGCCACTCTAAAAAAATAATGCACGCCCTCGATAAAC
GTTTATCGAGGGCGTGCATTATTTTTTTAGAGTGGCCGAAGATAACAAGCGTAACGGTTTTATTTGTTGTCCATGCAACAAGTGTAAGAACCAGAAGAAG[T/C]
ATTCTGCATCCAGGACTATTCATTTCCACTTGTTTGAGTCGGGGTTCATGCCAAGCTATAATTGTTTGAGTCGGGGTTCATGCCAAGCTATAATTGTTGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.30% | 22.10% | 1.65% | 39.95% | NA |
| All Indica | 2759 | 13.40% | 31.00% | 2.14% | 53.46% | NA |
| All Japonica | 1512 | 82.70% | 10.40% | 0.40% | 6.42% | NA |
| Aus | 269 | 3.00% | 1.90% | 2.60% | 92.57% | NA |
| Indica I | 595 | 7.60% | 20.30% | 0.84% | 71.26% | NA |
| Indica II | 465 | 16.30% | 36.10% | 2.80% | 44.73% | NA |
| Indica III | 913 | 17.60% | 37.00% | 1.86% | 43.48% | NA |
| Indica Intermediate | 786 | 11.10% | 29.10% | 3.05% | 56.74% | NA |
| Temperate Japonica | 767 | 86.00% | 6.00% | 0.26% | 7.69% | NA |
| Tropical Japonica | 504 | 79.40% | 17.70% | 0.40% | 2.58% | NA |
| Japonica Intermediate | 241 | 79.30% | 9.50% | 0.83% | 10.37% | NA |
| VI/Aromatic | 96 | 53.10% | 2.10% | 3.12% | 41.67% | NA |
| Intermediate | 90 | 41.10% | 25.60% | 3.33% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005176953 | A -> G | LOC_Os10g09590.1 | downstream_gene_variant ; 4025.0bp to feature; MODIFIER | silent_mutation | Average:19.244; most accessible tissue: Minghui63 flag leaf, score: 32.17 | N | N | N | N |
| vg1005176953 | A -> G | LOC_Os10g09570-LOC_Os10g09590 | intergenic_region ; MODIFIER | silent_mutation | Average:19.244; most accessible tissue: Minghui63 flag leaf, score: 32.17 | N | N | N | N |
| vg1005176953 | A -> DEL | N | N | silent_mutation | Average:19.244; most accessible tissue: Minghui63 flag leaf, score: 32.17 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005176953 | NA | 3.95E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005176953 | NA | 6.36E-06 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005176953 | 3.78E-06 | 2.78E-07 | mr1053_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005176953 | NA | 4.71E-06 | mr1147_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005176953 | 7.65E-06 | 7.65E-06 | mr1151_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005176953 | NA | 6.88E-06 | mr1264_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005176953 | NA | 6.37E-06 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |