Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1005176953:

Variant ID: vg1005176953 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5176953
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.04, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:

CCAACAATTATAGCTTGGCATGAACCCCGACTCAAACAATTATAGCTTGGCATGAACCCCGACTCAAACAAGTGGAAATGAATAGTCCTGGATGCAGAAT[A/G]
CTTCTTCTGGTTCTTACACTTGTTGCATGGACAACAAATAAAACCGTTACGCTTGTTATCTTCGGCCACTCTAAAAAAATAATGCACGCCCTCGATAAAC

Reverse complement sequence

GTTTATCGAGGGCGTGCATTATTTTTTTAGAGTGGCCGAAGATAACAAGCGTAACGGTTTTATTTGTTGTCCATGCAACAAGTGTAAGAACCAGAAGAAG[T/C]
ATTCTGCATCCAGGACTATTCATTTCCACTTGTTTGAGTCGGGGTTCATGCCAAGCTATAATTGTTTGAGTCGGGGTTCATGCCAAGCTATAATTGTTGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.30%	22.10%	1.65%	39.95%	NA
All Indica	2759	13.40%	31.00%	2.14%	53.46%	NA
All Japonica	1512	82.70%	10.40%	0.40%	6.42%	NA
Aus	269	3.00%	1.90%	2.60%	92.57%	NA
Indica I	595	7.60%	20.30%	0.84%	71.26%	NA
Indica II	465	16.30%	36.10%	2.80%	44.73%	NA
Indica III	913	17.60%	37.00%	1.86%	43.48%	NA
Indica Intermediate	786	11.10%	29.10%	3.05%	56.74%	NA
Temperate Japonica	767	86.00%	6.00%	0.26%	7.69%	NA
Tropical Japonica	504	79.40%	17.70%	0.40%	2.58%	NA
Japonica Intermediate	241	79.30%	9.50%	0.83%	10.37%	NA
VI/Aromatic	96	53.10%	2.10%	3.12%	41.67%	NA
Intermediate	90	41.10%	25.60%	3.33%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005176953	A -> G	LOC_Os10g09590.1	downstream_gene_variant ; 4025.0bp to feature; MODIFIER	silent_mutation	Average:19.244; most accessible tissue: Minghui63 flag leaf, score: 32.17	N	N	N	N
vg1005176953	A -> G	LOC_Os10g09570-LOC_Os10g09590	intergenic_region ; MODIFIER	silent_mutation	Average:19.244; most accessible tissue: Minghui63 flag leaf, score: 32.17	N	N	N	N
vg1005176953	A -> DEL	N	N	silent_mutation	Average:19.244; most accessible tissue: Minghui63 flag leaf, score: 32.17	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005176953	NA	3.95E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005176953	NA	6.36E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005176953	3.78E-06	2.78E-07	mr1053_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005176953	NA	4.71E-06	mr1147_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005176953	7.65E-06	7.65E-06	mr1151_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005176953	NA	6.88E-06	mr1264_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005176953	NA	6.37E-06	mr1308_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251