\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005176953:

Variant ID: vg1005176953 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5176953
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.04, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


CCAACAATTATAGCTTGGCATGAACCCCGACTCAAACAATTATAGCTTGGCATGAACCCCGACTCAAACAAGTGGAAATGAATAGTCCTGGATGCAGAAT[A/G]
CTTCTTCTGGTTCTTACACTTGTTGCATGGACAACAAATAAAACCGTTACGCTTGTTATCTTCGGCCACTCTAAAAAAATAATGCACGCCCTCGATAAAC

Reverse complement sequence

GTTTATCGAGGGCGTGCATTATTTTTTTAGAGTGGCCGAAGATAACAAGCGTAACGGTTTTATTTGTTGTCCATGCAACAAGTGTAAGAACCAGAAGAAG[T/C]
ATTCTGCATCCAGGACTATTCATTTCCACTTGTTTGAGTCGGGGTTCATGCCAAGCTATAATTGTTTGAGTCGGGGTTCATGCCAAGCTATAATTGTTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.30% 22.10% 1.65% 39.95% NA
All Indica  2759 13.40% 31.00% 2.14% 53.46% NA
All Japonica  1512 82.70% 10.40% 0.40% 6.42% NA
Aus  269 3.00% 1.90% 2.60% 92.57% NA
Indica I  595 7.60% 20.30% 0.84% 71.26% NA
Indica II  465 16.30% 36.10% 2.80% 44.73% NA
Indica III  913 17.60% 37.00% 1.86% 43.48% NA
Indica Intermediate  786 11.10% 29.10% 3.05% 56.74% NA
Temperate Japonica  767 86.00% 6.00% 0.26% 7.69% NA
Tropical Japonica  504 79.40% 17.70% 0.40% 2.58% NA
Japonica Intermediate  241 79.30% 9.50% 0.83% 10.37% NA
VI/Aromatic  96 53.10% 2.10% 3.12% 41.67% NA
Intermediate  90 41.10% 25.60% 3.33% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005176953 A -> G LOC_Os10g09590.1 downstream_gene_variant ; 4025.0bp to feature; MODIFIER silent_mutation Average:19.244; most accessible tissue: Minghui63 flag leaf, score: 32.17 N N N N
vg1005176953 A -> G LOC_Os10g09570-LOC_Os10g09590 intergenic_region ; MODIFIER silent_mutation Average:19.244; most accessible tissue: Minghui63 flag leaf, score: 32.17 N N N N
vg1005176953 A -> DEL N N silent_mutation Average:19.244; most accessible tissue: Minghui63 flag leaf, score: 32.17 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005176953 NA 3.95E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005176953 NA 6.36E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005176953 3.78E-06 2.78E-07 mr1053_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005176953 NA 4.71E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005176953 7.65E-06 7.65E-06 mr1151_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005176953 NA 6.88E-06 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005176953 NA 6.37E-06 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251