Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005048726:

Variant ID: vg1005048726 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5048726
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGGTGAGATTTTGATTAAAAATGATACTAATAAAACTGTGTTTAAATCTGCTGGTATCATGTCTACCATGAATTCATCTTCTTCAAAATCCAATGTTGT[G/A]
CATGCAAAACCTCTTGTTTCTGCTTGTGTTGCTAAATCTTCTTGCTCTAACAATGTGTCTAAACAACGTGAGAAATATACTTGTTCTTTTTGTGGTAAAG

Reverse complement sequence

CTTTACCACAAAAAGAACAAGTATATTTCTCACGTTGTTTAGACACATTGTTAGAGCAAGAAGATTTAGCAACACAAGCAGAAACAAGAGGTTTTGCATG[C/T]
ACAACATTGGATTTTGAAGAAGATGAATTCATGGTAGACATGATACCAGCAGATTTAAACACAGTTTTATTAGTATCATTTTTAATCAAAATCTCACCAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.80%	0.30%	3.07%	26.85%	NA
All Indica	2759	68.60%	0.50%	3.01%	27.94%	NA
All Japonica	1512	76.10%	0.00%	2.65%	21.30%	NA
Aus	269	39.00%	0.70%	7.43%	52.79%	NA
Indica I	595	79.50%	0.20%	2.18%	18.15%	NA
Indica II	465	51.40%	0.60%	3.87%	44.09%	NA
Indica III	913	72.90%	0.50%	3.07%	23.44%	NA
Indica Intermediate	786	65.40%	0.50%	3.05%	31.04%	NA
Temperate Japonica	767	85.90%	0.00%	1.17%	12.91%	NA
Tropical Japonica	504	64.50%	0.00%	4.56%	30.95%	NA
Japonica Intermediate	241	68.90%	0.00%	3.32%	27.80%	NA
VI/Aromatic	96	83.30%	0.00%	0.00%	16.67%	NA
Intermediate	90	77.80%	0.00%	2.22%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005048726	G -> A	LOC_Os10g09340.1	upstream_gene_variant ; 3466.0bp to feature; MODIFIER	silent_mutation	Average:6.287; most accessible tissue: Callus, score: 18.157	N	N	N	N
vg1005048726	G -> A	LOC_Os10g09330.1	downstream_gene_variant ; 4537.0bp to feature; MODIFIER	silent_mutation	Average:6.287; most accessible tissue: Callus, score: 18.157	N	N	N	N
vg1005048726	G -> A	LOC_Os10g09350.1	intron_variant ; MODIFIER	silent_mutation	Average:6.287; most accessible tissue: Callus, score: 18.157	N	N	N	N
vg1005048726	G -> DEL	N	N	silent_mutation	Average:6.287; most accessible tissue: Callus, score: 18.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005048726	7.42E-06	NA	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005048726	1.90E-06	NA	mr1758	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251