\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005031656:

Variant ID: vg1005031656 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5031656
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.59, G: 0.39, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTAGTGCTGCATCAGTTAAGTTTGATCTACTAAGTCGTGCTTAGAACCATAATCTCTAGCCTGCTTCTTGATTGCCAATAGGGGTTGGGTTTCAGCCG[A/G]
TGAGTTATCTGGATGTTGCATCGGCTCATAAGGATTTCATATACATATAAGTTGGATTTAGCCGATGACAACAAAAGTTTCATTGTTTAATCTAATCTTG

Reverse complement sequence

CAAGATTAGATTAAACAATGAAACTTTTGTTGTCATCGGCTAAATCCAACTTATATGTATATGAAATCCTTATGAGCCGATGCAACATCCAGATAACTCA[T/C]
CGGCTGAAACCCAACCCCTATTGGCAATCAAGAAGCAGGCTAGAGATTATGGTTCTAAGCACGACTTAGTAGATCAAACTTAACTGATGCAGCACTAAGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.00% 12.80% 46.59% 4.63% NA
All Indica  2759 20.30% 16.80% 60.49% 2.39% NA
All Japonica  1512 66.90% 8.60% 15.08% 9.39% NA
Aus  269 16.00% 0.70% 81.78% 1.49% NA
Indica I  595 40.70% 2.40% 52.61% 4.37% NA
Indica II  465 13.80% 39.10% 45.81% 1.29% NA
Indica III  913 8.20% 14.00% 76.12% 1.64% NA
Indica Intermediate  786 22.90% 17.70% 57.00% 2.42% NA
Temperate Japonica  767 78.60% 2.30% 7.17% 11.86% NA
Tropical Japonica  504 53.80% 19.00% 22.82% 4.37% NA
Japonica Intermediate  241 57.30% 6.60% 24.07% 12.03% NA
VI/Aromatic  96 41.70% 2.10% 50.00% 6.25% NA
Intermediate  90 50.00% 7.80% 41.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005031656 A -> G LOC_Os10g09290.1 upstream_gene_variant ; 4338.0bp to feature; MODIFIER silent_mutation Average:10.451; most accessible tissue: Callus, score: 17.169 N N N N
vg1005031656 A -> G LOC_Os10g09300.1 upstream_gene_variant ; 1899.0bp to feature; MODIFIER silent_mutation Average:10.451; most accessible tissue: Callus, score: 17.169 N N N N
vg1005031656 A -> G LOC_Os10g09310.1 downstream_gene_variant ; 639.0bp to feature; MODIFIER silent_mutation Average:10.451; most accessible tissue: Callus, score: 17.169 N N N N
vg1005031656 A -> G LOC_Os10g09300-LOC_Os10g09310 intergenic_region ; MODIFIER silent_mutation Average:10.451; most accessible tissue: Callus, score: 17.169 N N N N
vg1005031656 A -> DEL N N silent_mutation Average:10.451; most accessible tissue: Callus, score: 17.169 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005031656 NA 2.34E-12 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656 NA 1.48E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656 4.98E-06 6.92E-13 mr1018 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656 NA 3.32E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656 NA 1.40E-12 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656 NA 1.42E-11 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656 NA 1.27E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656 2.52E-06 NA mr1390 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656 1.90E-06 4.02E-14 mr1390 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656 7.46E-07 8.54E-15 mr1490 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656 NA 1.08E-08 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656 NA 1.19E-12 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656 NA 8.27E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656 NA 9.78E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656 9.46E-06 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656 NA 7.21E-15 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656 NA 3.20E-14 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251