Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005031656:

Variant ID: vg1005031656 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5031656
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.59, G: 0.39, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:

ACTTAGTGCTGCATCAGTTAAGTTTGATCTACTAAGTCGTGCTTAGAACCATAATCTCTAGCCTGCTTCTTGATTGCCAATAGGGGTTGGGTTTCAGCCG[A/G]
TGAGTTATCTGGATGTTGCATCGGCTCATAAGGATTTCATATACATATAAGTTGGATTTAGCCGATGACAACAAAAGTTTCATTGTTTAATCTAATCTTG

Reverse complement sequence

CAAGATTAGATTAAACAATGAAACTTTTGTTGTCATCGGCTAAATCCAACTTATATGTATATGAAATCCTTATGAGCCGATGCAACATCCAGATAACTCA[T/C]
CGGCTGAAACCCAACCCCTATTGGCAATCAAGAAGCAGGCTAGAGATTATGGTTCTAAGCACGACTTAGTAGATCAAACTTAACTGATGCAGCACTAAGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.00%	12.80%	46.59%	4.63%	NA
All Indica	2759	20.30%	16.80%	60.49%	2.39%	NA
All Japonica	1512	66.90%	8.60%	15.08%	9.39%	NA
Aus	269	16.00%	0.70%	81.78%	1.49%	NA
Indica I	595	40.70%	2.40%	52.61%	4.37%	NA
Indica II	465	13.80%	39.10%	45.81%	1.29%	NA
Indica III	913	8.20%	14.00%	76.12%	1.64%	NA
Indica Intermediate	786	22.90%	17.70%	57.00%	2.42%	NA
Temperate Japonica	767	78.60%	2.30%	7.17%	11.86%	NA
Tropical Japonica	504	53.80%	19.00%	22.82%	4.37%	NA
Japonica Intermediate	241	57.30%	6.60%	24.07%	12.03%	NA
VI/Aromatic	96	41.70%	2.10%	50.00%	6.25%	NA
Intermediate	90	50.00%	7.80%	41.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005031656	A -> G	LOC_Os10g09290.1	upstream_gene_variant ; 4338.0bp to feature; MODIFIER	silent_mutation	Average:10.451; most accessible tissue: Callus, score: 17.169	N	N	N	N
vg1005031656	A -> G	LOC_Os10g09300.1	upstream_gene_variant ; 1899.0bp to feature; MODIFIER	silent_mutation	Average:10.451; most accessible tissue: Callus, score: 17.169	N	N	N	N
vg1005031656	A -> G	LOC_Os10g09310.1	downstream_gene_variant ; 639.0bp to feature; MODIFIER	silent_mutation	Average:10.451; most accessible tissue: Callus, score: 17.169	N	N	N	N
vg1005031656	A -> G	LOC_Os10g09300-LOC_Os10g09310	intergenic_region ; MODIFIER	silent_mutation	Average:10.451; most accessible tissue: Callus, score: 17.169	N	N	N	N
vg1005031656	A -> DEL	N	N	silent_mutation	Average:10.451; most accessible tissue: Callus, score: 17.169	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005031656	NA	2.34E-12	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656	NA	1.48E-10	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656	4.98E-06	6.92E-13	mr1018	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656	NA	3.32E-08	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656	NA	1.40E-12	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656	NA	1.42E-11	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656	NA	1.27E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656	2.52E-06	NA	mr1390	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656	1.90E-06	4.02E-14	mr1390	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656	7.46E-07	8.54E-15	mr1490	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656	NA	1.08E-08	mr1022_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656	NA	1.19E-12	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656	NA	8.27E-13	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656	NA	9.78E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656	9.46E-06	NA	mr1390_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656	NA	7.21E-15	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005031656	NA	3.20E-14	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251