\
| Variant ID: vg1005031656 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5031656 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.59, G: 0.39, others allele: 0.00, population size: 41. )
ACTTAGTGCTGCATCAGTTAAGTTTGATCTACTAAGTCGTGCTTAGAACCATAATCTCTAGCCTGCTTCTTGATTGCCAATAGGGGTTGGGTTTCAGCCG[A/G]
TGAGTTATCTGGATGTTGCATCGGCTCATAAGGATTTCATATACATATAAGTTGGATTTAGCCGATGACAACAAAAGTTTCATTGTTTAATCTAATCTTG
CAAGATTAGATTAAACAATGAAACTTTTGTTGTCATCGGCTAAATCCAACTTATATGTATATGAAATCCTTATGAGCCGATGCAACATCCAGATAACTCA[T/C]
CGGCTGAAACCCAACCCCTATTGGCAATCAAGAAGCAGGCTAGAGATTATGGTTCTAAGCACGACTTAGTAGATCAAACTTAACTGATGCAGCACTAAGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.00% | 12.80% | 46.59% | 4.63% | NA |
| All Indica | 2759 | 20.30% | 16.80% | 60.49% | 2.39% | NA |
| All Japonica | 1512 | 66.90% | 8.60% | 15.08% | 9.39% | NA |
| Aus | 269 | 16.00% | 0.70% | 81.78% | 1.49% | NA |
| Indica I | 595 | 40.70% | 2.40% | 52.61% | 4.37% | NA |
| Indica II | 465 | 13.80% | 39.10% | 45.81% | 1.29% | NA |
| Indica III | 913 | 8.20% | 14.00% | 76.12% | 1.64% | NA |
| Indica Intermediate | 786 | 22.90% | 17.70% | 57.00% | 2.42% | NA |
| Temperate Japonica | 767 | 78.60% | 2.30% | 7.17% | 11.86% | NA |
| Tropical Japonica | 504 | 53.80% | 19.00% | 22.82% | 4.37% | NA |
| Japonica Intermediate | 241 | 57.30% | 6.60% | 24.07% | 12.03% | NA |
| VI/Aromatic | 96 | 41.70% | 2.10% | 50.00% | 6.25% | NA |
| Intermediate | 90 | 50.00% | 7.80% | 41.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005031656 | A -> G | LOC_Os10g09290.1 | upstream_gene_variant ; 4338.0bp to feature; MODIFIER | silent_mutation | Average:10.451; most accessible tissue: Callus, score: 17.169 | N | N | N | N |
| vg1005031656 | A -> G | LOC_Os10g09300.1 | upstream_gene_variant ; 1899.0bp to feature; MODIFIER | silent_mutation | Average:10.451; most accessible tissue: Callus, score: 17.169 | N | N | N | N |
| vg1005031656 | A -> G | LOC_Os10g09310.1 | downstream_gene_variant ; 639.0bp to feature; MODIFIER | silent_mutation | Average:10.451; most accessible tissue: Callus, score: 17.169 | N | N | N | N |
| vg1005031656 | A -> G | LOC_Os10g09300-LOC_Os10g09310 | intergenic_region ; MODIFIER | silent_mutation | Average:10.451; most accessible tissue: Callus, score: 17.169 | N | N | N | N |
| vg1005031656 | A -> DEL | N | N | silent_mutation | Average:10.451; most accessible tissue: Callus, score: 17.169 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005031656 | NA | 2.34E-12 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005031656 | NA | 1.48E-10 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005031656 | 4.98E-06 | 6.92E-13 | mr1018 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005031656 | NA | 3.32E-08 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005031656 | NA | 1.40E-12 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005031656 | NA | 1.42E-11 | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005031656 | NA | 1.27E-06 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005031656 | 2.52E-06 | NA | mr1390 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005031656 | 1.90E-06 | 4.02E-14 | mr1390 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005031656 | 7.46E-07 | 8.54E-15 | mr1490 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005031656 | NA | 1.08E-08 | mr1022_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005031656 | NA | 1.19E-12 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005031656 | NA | 8.27E-13 | mr1178_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005031656 | NA | 9.78E-06 | mr1293_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005031656 | 9.46E-06 | NA | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005031656 | NA | 7.21E-15 | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005031656 | NA | 3.20E-14 | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |