Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1005025105:

Variant ID: vg1005025105 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5025105
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.40, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

ACCTCAGAAATGTAGAACTGGCCTCTATCGTGAAGGCTTCCGCAGCCTCCCCTATTCAGTAAAATTAAGCATTTTAGTATTGATCAATCGCCTAACTAAC[A/G]
CAATTCATAAGCCCAATCTATTTTTAGATACCTATTATACTTGCCAAATTTCATAAATCAGTATAACGTAGTCAGATAAAAAAAATGCAAATAGACATGG

Reverse complement sequence

CCATGTCTATTTGCATTTTTTTTATCTGACTACGTTATACTGATTTATGAAATTTGGCAAGTATAATAGGTATCTAAAAATAGATTGGGCTTATGAATTG[T/C]
GTTAGTTAGGCGATTGATCAATACTAAAATGCTTAATTTTACTGAATAGGGGAGGCTGCGGAAGCCTTCACGATAGAGGCCAGTTCTACATTTCTGAGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.60%	21.30%	6.03%	14.09%	NA
All Indica	2759	39.10%	31.80%	9.50%	19.54%	NA
All Japonica	1512	99.10%	0.40%	0.46%	0.07%	NA
Aus	269	13.00%	36.80%	4.46%	45.72%	NA
Indica I	595	41.80%	14.80%	4.03%	39.33%	NA
Indica II	465	32.70%	52.30%	8.17%	6.88%	NA
Indica III	913	44.40%	26.70%	16.43%	12.49%	NA
Indica Intermediate	786	34.90%	38.50%	6.36%	20.23%	NA
Temperate Japonica	767	99.20%	0.30%	0.52%	0.00%	NA
Tropical Japonica	504	98.60%	0.80%	0.60%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	84.40%	13.50%	2.08%	0.00%	NA
Intermediate	90	82.20%	12.20%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005025105	A -> G	LOC_Os10g09280.1	downstream_gene_variant ; 2190.0bp to feature; MODIFIER	silent_mutation	Average:16.138; most accessible tissue: Minghui63 root, score: 31.271	N	N	N	N
vg1005025105	A -> G	LOC_Os10g09300.1	downstream_gene_variant ; 2901.0bp to feature; MODIFIER	silent_mutation	Average:16.138; most accessible tissue: Minghui63 root, score: 31.271	N	N	N	N
vg1005025105	A -> G	LOC_Os10g09290.1	intron_variant ; MODIFIER	silent_mutation	Average:16.138; most accessible tissue: Minghui63 root, score: 31.271	N	N	N	N
vg1005025105	A -> DEL	N	N	silent_mutation	Average:16.138; most accessible tissue: Minghui63 root, score: 31.271	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005025105	NA	5.31E-06	mr1699	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005025105	3.30E-06	NA	mr1829_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005025105	7.62E-07	NA	mr1933_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251