\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005025105:

Variant ID: vg1005025105 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5025105
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.40, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTCAGAAATGTAGAACTGGCCTCTATCGTGAAGGCTTCCGCAGCCTCCCCTATTCAGTAAAATTAAGCATTTTAGTATTGATCAATCGCCTAACTAAC[A/G]
CAATTCATAAGCCCAATCTATTTTTAGATACCTATTATACTTGCCAAATTTCATAAATCAGTATAACGTAGTCAGATAAAAAAAATGCAAATAGACATGG

Reverse complement sequence

CCATGTCTATTTGCATTTTTTTTATCTGACTACGTTATACTGATTTATGAAATTTGGCAAGTATAATAGGTATCTAAAAATAGATTGGGCTTATGAATTG[T/C]
GTTAGTTAGGCGATTGATCAATACTAAAATGCTTAATTTTACTGAATAGGGGAGGCTGCGGAAGCCTTCACGATAGAGGCCAGTTCTACATTTCTGAGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.60% 21.30% 6.03% 14.09% NA
All Indica  2759 39.10% 31.80% 9.50% 19.54% NA
All Japonica  1512 99.10% 0.40% 0.46% 0.07% NA
Aus  269 13.00% 36.80% 4.46% 45.72% NA
Indica I  595 41.80% 14.80% 4.03% 39.33% NA
Indica II  465 32.70% 52.30% 8.17% 6.88% NA
Indica III  913 44.40% 26.70% 16.43% 12.49% NA
Indica Intermediate  786 34.90% 38.50% 6.36% 20.23% NA
Temperate Japonica  767 99.20% 0.30% 0.52% 0.00% NA
Tropical Japonica  504 98.60% 0.80% 0.60% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 84.40% 13.50% 2.08% 0.00% NA
Intermediate  90 82.20% 12.20% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005025105 A -> G LOC_Os10g09280.1 downstream_gene_variant ; 2190.0bp to feature; MODIFIER silent_mutation Average:16.138; most accessible tissue: Minghui63 root, score: 31.271 N N N N
vg1005025105 A -> G LOC_Os10g09300.1 downstream_gene_variant ; 2901.0bp to feature; MODIFIER silent_mutation Average:16.138; most accessible tissue: Minghui63 root, score: 31.271 N N N N
vg1005025105 A -> G LOC_Os10g09290.1 intron_variant ; MODIFIER silent_mutation Average:16.138; most accessible tissue: Minghui63 root, score: 31.271 N N N N
vg1005025105 A -> DEL N N silent_mutation Average:16.138; most accessible tissue: Minghui63 root, score: 31.271 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005025105 NA 5.31E-06 mr1699 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005025105 3.30E-06 NA mr1829_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005025105 7.62E-07 NA mr1933_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251