\
| Variant ID: vg1005025105 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5025105 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.40, others allele: 0.00, population size: 55. )
ACCTCAGAAATGTAGAACTGGCCTCTATCGTGAAGGCTTCCGCAGCCTCCCCTATTCAGTAAAATTAAGCATTTTAGTATTGATCAATCGCCTAACTAAC[A/G]
CAATTCATAAGCCCAATCTATTTTTAGATACCTATTATACTTGCCAAATTTCATAAATCAGTATAACGTAGTCAGATAAAAAAAATGCAAATAGACATGG
CCATGTCTATTTGCATTTTTTTTATCTGACTACGTTATACTGATTTATGAAATTTGGCAAGTATAATAGGTATCTAAAAATAGATTGGGCTTATGAATTG[T/C]
GTTAGTTAGGCGATTGATCAATACTAAAATGCTTAATTTTACTGAATAGGGGAGGCTGCGGAAGCCTTCACGATAGAGGCCAGTTCTACATTTCTGAGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.60% | 21.30% | 6.03% | 14.09% | NA |
| All Indica | 2759 | 39.10% | 31.80% | 9.50% | 19.54% | NA |
| All Japonica | 1512 | 99.10% | 0.40% | 0.46% | 0.07% | NA |
| Aus | 269 | 13.00% | 36.80% | 4.46% | 45.72% | NA |
| Indica I | 595 | 41.80% | 14.80% | 4.03% | 39.33% | NA |
| Indica II | 465 | 32.70% | 52.30% | 8.17% | 6.88% | NA |
| Indica III | 913 | 44.40% | 26.70% | 16.43% | 12.49% | NA |
| Indica Intermediate | 786 | 34.90% | 38.50% | 6.36% | 20.23% | NA |
| Temperate Japonica | 767 | 99.20% | 0.30% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 0.80% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 84.40% | 13.50% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 12.20% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005025105 | A -> G | LOC_Os10g09280.1 | downstream_gene_variant ; 2190.0bp to feature; MODIFIER | silent_mutation | Average:16.138; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| vg1005025105 | A -> G | LOC_Os10g09300.1 | downstream_gene_variant ; 2901.0bp to feature; MODIFIER | silent_mutation | Average:16.138; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| vg1005025105 | A -> G | LOC_Os10g09290.1 | intron_variant ; MODIFIER | silent_mutation | Average:16.138; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| vg1005025105 | A -> DEL | N | N | silent_mutation | Average:16.138; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005025105 | NA | 5.31E-06 | mr1699 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005025105 | 3.30E-06 | NA | mr1829_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005025105 | 7.62E-07 | NA | mr1933_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |