RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1004990336:

Variant ID: vg1004990336 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4990336
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGAACAACGGTTTAAACGTTGAACTTTTCTGTGTTTGTTCCAATTTTCCTCGAAATATACTAATTTGAAACTCGGGACATTACAAGTATAGGGCTCCACC[A/G]
ACATGTGTTTAATTCCAAGTCAAAGTATGCAGGTGAGCATGCATTAAATTCTCCATTAATCATGTTATATATAATTAAGAGAATTTCCTAAATTAAAATA

Reverse complement sequence

TATTTTAATTTAGGAAATTCTCTTAATTATATATAACATGATTAATGGAGAATTTAATGCATGCTCACCTGCATACTTTGACTTGGAATTAAACACATGT[T/C]
GGTGGAGCCCTATACTTGTAATGTCCCGAGTTTCAAATTAGTATATTTCGAGGAAAATTGGAACAAACACAGAAAAGTTCAACGTTTAAACCGTTGTTCG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.50%	0.80%	1.82%	0.93%	NA
All Indica	2759	95.90%	0.00%	2.75%	1.38%	NA
All Japonica	1512	97.50%	2.40%	0.13%	0.00%	NA
Aus	269	95.90%	0.00%	1.86%	2.23%	NA
Indica I	595	95.80%	0.00%	2.69%	1.51%	NA
Indica II	465	95.30%	0.00%	3.01%	1.72%	NA
Indica III	913	95.60%	0.00%	2.96%	1.42%	NA
Indica Intermediate	786	96.60%	0.00%	2.42%	1.02%	NA
Temperate Japonica	767	95.00%	4.70%	0.26%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	97.80%	0.00%	2.22%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004990336	A -> G	LOC_Os10g09220.1	upstream_gene_variant ; 3771.0bp to feature; MODIFIER	silent_mutation	Average:30.003; most accessible tissue: Callus, score: 54.125	N	N	N	N
vg1004990336	A -> G	LOC_Os10g09240.1	downstream_gene_variant ; 4162.0bp to feature; MODIFIER	silent_mutation	Average:30.003; most accessible tissue: Callus, score: 54.125	N	N	N	N
vg1004990336	A -> G	LOC_Os10g09220-LOC_Os10g09240	intergenic_region ; MODIFIER	silent_mutation	Average:30.003; most accessible tissue: Callus, score: 54.125	N	N	N	N
vg1004990336	A -> DEL	N	N	silent_mutation	Average:30.003; most accessible tissue: Callus, score: 54.125	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004990336	3.54E-06	1.16E-07	mr1300	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004990336	7.70E-06	3.60E-07	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004990336	NA	7.76E-06	mr1959	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 3 of 3 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg1004990336:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact