\
| Variant ID: vg1004963171 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4963171 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TATCTATTAATTAGGAATAGTACATTAGTTTCCTGTTATCTTTAGGAAAGTGTGTTTAGTGTCTGATATGCACTTTATGTTTTCCATTTATCCTTAGGAA[A/G]
GTTTCTTTCTTGTATAAGGACAAGTATCTATCCATAGGTATAAATATGTACATCCGAGGTCATTGAAAATTATCTCTCGATCAATACAACTACTCTCGGC
GCCGAGAGTAGTTGTATTGATCGAGAGATAATTTTCAATGACCTCGGATGTACATATTTATACCTATGGATAGATACTTGTCCTTATACAAGAAAGAAAC[T/C]
TTCCTAAGGATAAATGGAAAACATAAAGTGCATATCAGACACTAAACACACTTTCCTAAAGATAACAGGAAACTAATGTACTATTCCTAATTAATAGATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.60% | 21.50% | 8.70% | 27.19% | NA |
| All Indica | 2759 | 52.80% | 2.40% | 12.43% | 32.44% | NA |
| All Japonica | 1512 | 19.50% | 58.30% | 1.59% | 20.57% | NA |
| Aus | 269 | 66.50% | 1.50% | 13.75% | 18.22% | NA |
| Indica I | 595 | 38.80% | 1.70% | 20.67% | 38.82% | NA |
| Indica II | 465 | 50.30% | 2.20% | 10.54% | 36.99% | NA |
| Indica III | 913 | 65.00% | 2.00% | 7.23% | 25.85% | NA |
| Indica Intermediate | 786 | 50.60% | 3.40% | 13.36% | 32.57% | NA |
| Temperate Japonica | 767 | 12.50% | 66.90% | 1.30% | 19.30% | NA |
| Tropical Japonica | 504 | 26.20% | 49.80% | 1.79% | 22.22% | NA |
| Japonica Intermediate | 241 | 27.80% | 49.00% | 2.07% | 21.16% | NA |
| VI/Aromatic | 96 | 53.10% | 38.50% | 1.04% | 7.29% | NA |
| Intermediate | 90 | 36.70% | 31.10% | 6.67% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004963171 | A -> G | LOC_Os10g09200.1 | upstream_gene_variant ; 3351.0bp to feature; MODIFIER | silent_mutation | Average:17.673; most accessible tissue: Callus, score: 44.276 | N | N | N | N |
| vg1004963171 | A -> G | LOC_Os10g09180.1 | downstream_gene_variant ; 3859.0bp to feature; MODIFIER | silent_mutation | Average:17.673; most accessible tissue: Callus, score: 44.276 | N | N | N | N |
| vg1004963171 | A -> G | LOC_Os10g09190.1 | downstream_gene_variant ; 1042.0bp to feature; MODIFIER | silent_mutation | Average:17.673; most accessible tissue: Callus, score: 44.276 | N | N | N | N |
| vg1004963171 | A -> G | LOC_Os10g09190-LOC_Os10g09200 | intergenic_region ; MODIFIER | silent_mutation | Average:17.673; most accessible tissue: Callus, score: 44.276 | N | N | N | N |
| vg1004963171 | A -> DEL | N | N | silent_mutation | Average:17.673; most accessible tissue: Callus, score: 44.276 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004963171 | 8.11E-10 | 3.07E-23 | mr1768 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004963171 | 1.34E-06 | 1.79E-07 | mr1768 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004963171 | NA | 5.43E-07 | mr1768 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004963171 | NA | 1.26E-07 | mr1825 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004963171 | 4.97E-11 | 9.94E-34 | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004963171 | NA | 3.60E-07 | mr1768_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004963171 | NA | 4.67E-08 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |