\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004963171:

Variant ID: vg1004963171 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4963171
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATCTATTAATTAGGAATAGTACATTAGTTTCCTGTTATCTTTAGGAAAGTGTGTTTAGTGTCTGATATGCACTTTATGTTTTCCATTTATCCTTAGGAA[A/G]
GTTTCTTTCTTGTATAAGGACAAGTATCTATCCATAGGTATAAATATGTACATCCGAGGTCATTGAAAATTATCTCTCGATCAATACAACTACTCTCGGC

Reverse complement sequence

GCCGAGAGTAGTTGTATTGATCGAGAGATAATTTTCAATGACCTCGGATGTACATATTTATACCTATGGATAGATACTTGTCCTTATACAAGAAAGAAAC[T/C]
TTCCTAAGGATAAATGGAAAACATAAAGTGCATATCAGACACTAAACACACTTTCCTAAAGATAACAGGAAACTAATGTACTATTCCTAATTAATAGATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.60% 21.50% 8.70% 27.19% NA
All Indica  2759 52.80% 2.40% 12.43% 32.44% NA
All Japonica  1512 19.50% 58.30% 1.59% 20.57% NA
Aus  269 66.50% 1.50% 13.75% 18.22% NA
Indica I  595 38.80% 1.70% 20.67% 38.82% NA
Indica II  465 50.30% 2.20% 10.54% 36.99% NA
Indica III  913 65.00% 2.00% 7.23% 25.85% NA
Indica Intermediate  786 50.60% 3.40% 13.36% 32.57% NA
Temperate Japonica  767 12.50% 66.90% 1.30% 19.30% NA
Tropical Japonica  504 26.20% 49.80% 1.79% 22.22% NA
Japonica Intermediate  241 27.80% 49.00% 2.07% 21.16% NA
VI/Aromatic  96 53.10% 38.50% 1.04% 7.29% NA
Intermediate  90 36.70% 31.10% 6.67% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004963171 A -> G LOC_Os10g09200.1 upstream_gene_variant ; 3351.0bp to feature; MODIFIER silent_mutation Average:17.673; most accessible tissue: Callus, score: 44.276 N N N N
vg1004963171 A -> G LOC_Os10g09180.1 downstream_gene_variant ; 3859.0bp to feature; MODIFIER silent_mutation Average:17.673; most accessible tissue: Callus, score: 44.276 N N N N
vg1004963171 A -> G LOC_Os10g09190.1 downstream_gene_variant ; 1042.0bp to feature; MODIFIER silent_mutation Average:17.673; most accessible tissue: Callus, score: 44.276 N N N N
vg1004963171 A -> G LOC_Os10g09190-LOC_Os10g09200 intergenic_region ; MODIFIER silent_mutation Average:17.673; most accessible tissue: Callus, score: 44.276 N N N N
vg1004963171 A -> DEL N N silent_mutation Average:17.673; most accessible tissue: Callus, score: 44.276 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004963171 8.11E-10 3.07E-23 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004963171 1.34E-06 1.79E-07 mr1768 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004963171 NA 5.43E-07 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004963171 NA 1.26E-07 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004963171 4.97E-11 9.94E-34 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004963171 NA 3.60E-07 mr1768_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004963171 NA 4.67E-08 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251