Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004963171:

Variant ID: vg1004963171 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4963171
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATCTATTAATTAGGAATAGTACATTAGTTTCCTGTTATCTTTAGGAAAGTGTGTTTAGTGTCTGATATGCACTTTATGTTTTCCATTTATCCTTAGGAA[A/G]
GTTTCTTTCTTGTATAAGGACAAGTATCTATCCATAGGTATAAATATGTACATCCGAGGTCATTGAAAATTATCTCTCGATCAATACAACTACTCTCGGC

Reverse complement sequence

GCCGAGAGTAGTTGTATTGATCGAGAGATAATTTTCAATGACCTCGGATGTACATATTTATACCTATGGATAGATACTTGTCCTTATACAAGAAAGAAAC[T/C]
TTCCTAAGGATAAATGGAAAACATAAAGTGCATATCAGACACTAAACACACTTTCCTAAAGATAACAGGAAACTAATGTACTATTCCTAATTAATAGATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.60%	21.50%	8.70%	27.19%	NA
All Indica	2759	52.80%	2.40%	12.43%	32.44%	NA
All Japonica	1512	19.50%	58.30%	1.59%	20.57%	NA
Aus	269	66.50%	1.50%	13.75%	18.22%	NA
Indica I	595	38.80%	1.70%	20.67%	38.82%	NA
Indica II	465	50.30%	2.20%	10.54%	36.99%	NA
Indica III	913	65.00%	2.00%	7.23%	25.85%	NA
Indica Intermediate	786	50.60%	3.40%	13.36%	32.57%	NA
Temperate Japonica	767	12.50%	66.90%	1.30%	19.30%	NA
Tropical Japonica	504	26.20%	49.80%	1.79%	22.22%	NA
Japonica Intermediate	241	27.80%	49.00%	2.07%	21.16%	NA
VI/Aromatic	96	53.10%	38.50%	1.04%	7.29%	NA
Intermediate	90	36.70%	31.10%	6.67%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004963171	A -> G	LOC_Os10g09200.1	upstream_gene_variant ; 3351.0bp to feature; MODIFIER	silent_mutation	Average:17.673; most accessible tissue: Callus, score: 44.276	N	N	N	N
vg1004963171	A -> G	LOC_Os10g09180.1	downstream_gene_variant ; 3859.0bp to feature; MODIFIER	silent_mutation	Average:17.673; most accessible tissue: Callus, score: 44.276	N	N	N	N
vg1004963171	A -> G	LOC_Os10g09190.1	downstream_gene_variant ; 1042.0bp to feature; MODIFIER	silent_mutation	Average:17.673; most accessible tissue: Callus, score: 44.276	N	N	N	N
vg1004963171	A -> G	LOC_Os10g09190-LOC_Os10g09200	intergenic_region ; MODIFIER	silent_mutation	Average:17.673; most accessible tissue: Callus, score: 44.276	N	N	N	N
vg1004963171	A -> DEL	N	N	silent_mutation	Average:17.673; most accessible tissue: Callus, score: 44.276	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004963171	8.11E-10	3.07E-23	mr1768	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004963171	1.34E-06	1.79E-07	mr1768	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004963171	NA	5.43E-07	mr1768	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004963171	NA	1.26E-07	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004963171	4.97E-11	9.94E-34	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004963171	NA	3.60E-07	mr1768_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004963171	NA	4.67E-08	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251