\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004957918:

Variant ID: vg1004957918 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4957918
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAGCACGAAATCATGACGACAAGGTGAAAATATTGGAGAGCCATCAAAGAACGAACCTAGACATCGCTCAGGTGAAAAAATTAGAATGCTTCTCCAACA[A/T]
ATCAGATCAGGTAAAGTCTGCAGGTAATGTAGTTATTTCCCAATTTGATCATTTATCTGAAAATCATACCTGCATCAGTAATATCATCATGAATAACTCC

Reverse complement sequence

GGAGTTATTCATGATGATATTACTGATGCAGGTATGATTTTCAGATAAATGATCAAATTGGGAAATAACTACATTACCTGCAGACTTTACCTGATCTGAT[T/A]
TGTTGGAGAAGCATTCTAATTTTTTCACCTGAGCGATGTCTAGGTTCGTTCTTTGATGGCTCTCCAATATTTTCACCTTGTCGTCATGATTTCGTGCTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 20.30% 8.55% 17.16% NA
All Indica  2759 73.90% 1.80% 7.10% 17.14% NA
All Japonica  1512 20.60% 55.80% 10.32% 13.29% NA
Aus  269 56.50% 1.10% 13.75% 28.62% NA
Indica I  595 54.80% 1.20% 15.13% 28.91% NA
Indica II  465 87.70% 1.90% 3.23% 7.10% NA
Indica III  913 80.00% 1.60% 4.82% 13.58% NA
Indica Intermediate  786 73.20% 2.50% 5.98% 18.32% NA
Temperate Japonica  767 6.90% 65.30% 14.86% 12.91% NA
Tropical Japonica  504 34.70% 45.00% 6.35% 13.89% NA
Japonica Intermediate  241 34.90% 47.70% 4.15% 13.28% NA
VI/Aromatic  96 15.60% 38.50% 6.25% 39.58% NA
Intermediate  90 35.60% 30.00% 10.00% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004957918 A -> T LOC_Os10g09180.1 missense_variant ; p.Lys233Ile; MODERATE nonsynonymous_codon ; K233I Average:20.895; most accessible tissue: Zhenshan97 panicle, score: 46.362 unknown unknown TOLERATED 0.24
vg1004957918 A -> DEL LOC_Os10g09180.1 N frameshift_variant Average:20.895; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004957918 3.47E-07 8.93E-20 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004957918 NA 1.32E-07 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004957918 2.65E-06 NA mr1748_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004957918 3.99E-10 4.00E-34 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004957918 NA 2.44E-06 mr1768_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004957918 NA 3.61E-08 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251