\
| Variant ID: vg1004919122 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4919122 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATATTTTTTTAAGCCGTGGATATGTATGTCAACAATTGTTGTTTGTGTACCCTAGCTGGTACTGGACAGGGGTTTAATGCACATTTAGCTTAGAAATTAT[A/G]
GTTCATTAATTTCTGGGCATGAAAGTGCGTAGCCCCGTGAGCCGTCTCGGCGTGAGCAGTGTCGACGTTTGATGTCGCGATTCCGGTATTTGCATAGTAT
ATACTATGCAAATACCGGAATCGCGACATCAAACGTCGACACTGCTCACGCCGAGACGGCTCACGGGGCTACGCACTTTCATGCCCAGAAATTAATGAAC[T/C]
ATAATTTCTAAGCTAAATGTGCATTAAACCCCTGTCCAGTACCAGCTAGGGTACACAAACAACAATTGTTGACATACATATCCACGGCTTAAAAAAATAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.50% | 22.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 35.80% | 64.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 23.50% | 76.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 50.00% | 50.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 45.20% | 54.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 72.90% | 27.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 31.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004919122 | A -> G | LOC_Os10g09090.1 | upstream_gene_variant ; 1732.0bp to feature; MODIFIER | silent_mutation | Average:46.821; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg1004919122 | A -> G | LOC_Os10g09100.1 | downstream_gene_variant ; 722.0bp to feature; MODIFIER | silent_mutation | Average:46.821; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg1004919122 | A -> G | LOC_Os10g09090-LOC_Os10g09100 | intergenic_region ; MODIFIER | silent_mutation | Average:46.821; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004919122 | 1.67E-06 | 5.57E-20 | mr1768 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004919122 | NA | 5.19E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004919122 | 5.18E-06 | NA | mr1077_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004919122 | 1.20E-07 | 2.34E-32 | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |