\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004919122:

Variant ID: vg1004919122 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4919122
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATATTTTTTTAAGCCGTGGATATGTATGTCAACAATTGTTGTTTGTGTACCCTAGCTGGTACTGGACAGGGGTTTAATGCACATTTAGCTTAGAAATTAT[A/G]
GTTCATTAATTTCTGGGCATGAAAGTGCGTAGCCCCGTGAGCCGTCTCGGCGTGAGCAGTGTCGACGTTTGATGTCGCGATTCCGGTATTTGCATAGTAT

Reverse complement sequence

ATACTATGCAAATACCGGAATCGCGACATCAAACGTCGACACTGCTCACGCCGAGACGGCTCACGGGGCTACGCACTTTCATGCCCAGAAATTAATGAAC[T/C]
ATAATTTCTAAGCTAAATGTGCATTAAACCCCTGTCCAGTACCAGCTAGGGTACACAAACAACAATTGTTGACATACATATCCACGGCTTAAAAAAATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.50% 22.50% 0.02% 0.00% NA
All Indica  2759 98.60% 1.40% 0.00% 0.00% NA
All Japonica  1512 35.80% 64.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 2.00% 0.00% 0.00% NA
Temperate Japonica  767 23.50% 76.50% 0.00% 0.00% NA
Tropical Japonica  504 50.00% 50.00% 0.00% 0.00% NA
Japonica Intermediate  241 45.20% 54.80% 0.00% 0.00% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 67.80% 31.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004919122 A -> G LOC_Os10g09090.1 upstream_gene_variant ; 1732.0bp to feature; MODIFIER silent_mutation Average:46.821; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg1004919122 A -> G LOC_Os10g09100.1 downstream_gene_variant ; 722.0bp to feature; MODIFIER silent_mutation Average:46.821; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg1004919122 A -> G LOC_Os10g09090-LOC_Os10g09100 intergenic_region ; MODIFIER silent_mutation Average:46.821; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004919122 1.67E-06 5.57E-20 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004919122 NA 5.19E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004919122 5.18E-06 NA mr1077_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004919122 1.20E-07 2.34E-32 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251